There are 41 clinical trials
There is sound evidence that quetiapine is effective in the treatment of manic and depressive episodes associated with Bipolar Disorder (BD) (Yatham et al 2006). However, even with the development of effective new treatment options, not all patients respond to treatments available. Biological markers have been investigated as predictors of response to treatment and of remission of symptoms. This would explain in part the individual's differences in the response to treatment, taking into account the genetic variability plus environmental factors influencing specific biological markers. A potential biological marker of response to treatment in BD would be the levels of neurotrophins, as they are, in fact, altered during acute mood episodes (Cunha et al 2006). Among neurotrophins, the Brain-Derived Neurotrophic Factor (BDNF) has been repeatedly and consistently reported to be associated with BD physiopathology (Post 2007). Furthermore, medications that are known to be effective in BD, like lithium and divalproex, increase BDNF levels.
Interestingly, a single nucleotide polymorphism at nucleotide196 (G/A) in the human BDNF gene at codon 66 (Val66Met) have been reported to be associated with a predisposition to BD in family-based studies (Rybakowski et al 2006, Green et al 2006). --- Val66Met ---
Furthermore, there are consistent findings in BD regarding the association of Val66Met polymorphism of BDNF gene with prefrontal cognitive impairment, which was recently confirmed in a large sample of bipolar subjects (Rybakowski et al 2006). --- Val66Met ---
In addition, crosssectional studies showed that the polymorphism of BDNF gene (Val66Met) was associated with response to lithium prophylaxis, but findings were not universal (Rybakowski et al 2005, Masui et al 2006). --- Val66Met ---
We also aim to investigate the polymorphism of BDNF gene (Val66Met) and its correlation with BDNF serum levels and treatment response. --- Val66Met ---
This study proposes to evaluate the effects of D-cycloserine (DCS) combined with cognitive-behavioral treatment with exposure therapy in a sample of patients who developed posttraumatic stress disorder (PTSD) as a consequence of various traumas (e.g., motor vehicle and accidents, burns and other injuries, combat, World Trade Center attack, etc.). In addition, this study hopes to determine whether a common human genetic single nucleotide polymorphism (SNP) in a growth factor, brain derived neurotrophic factor, BDNF SNP (Val66Met), predicts treatment response to PTSD. Patients living in areas that are not geographically proximal to the Weill-Cornell Medical Center New York City campus will receive cognitive behavioral therapy using telemedicine (videoconferencing technology). Overall, this study aims 1) to determine if subjects administered DCS show a significantly larger decrease in symptoms of PTSD as compared to those administered a placebo, 2) to determine if subjects administered DCS show a decrease in PTSD symptomatology significantly earlier (as measured by weeks) than those administered a placebo, 3) to determine if differences in symptomatology are evident at a 6-month follow-up and indicate long-term differences between groups, 4) to determine if the BDNF SNP predicts treatment response, 5)to determine if it is feasible and acceptable to provide imaginal exposure (IE) therapy for PTSD using videoconferencing technology.
In addition, this study hopes to determine whether a common human genetic single nucleotide polymorphism (SNP) in a growth factor, brain derived neurotrophic factor, BDNF SNP (Val66Met), predicts treatment response to PTSD. --- Val66Met ---
In addition, all participants will be genotyped once for the BDNF SNP (Val66Met) using a non-invasive saliva sample. --- Val66Met ---
There is sound evidence that quetiapine is effective in the treatment of manic and depressive episodes associated with Bipolar Disorder (BD) (Yatham et al 2006). However, even with the development of effective new treatment options, not all patients respond to treatments available. Biological markers have been investigated as predictors of response to treatment and of remission of symptoms. This would explain in part the individual's differences in the response to treatment, taking into account the genetic variability plus environmental factors influencing specific biological markers. A potential biological marker of response to treatment in BD would be the levels of neurotrophins, as they are, in fact, altered during acute mood episodes (Cunha et al 2006). Among neurotrophins, the Brain-Derived Neurotrophic Factor (BDNF) has been repeatedly and consistently reported to be associated with BD physiopathology (Post 2007). Furthermore, medications that are known to be effective in BD, like lithium and divalproex, increase BDNF levels.
Interestingly, a single nucleotide polymorphism at nucleotide196 (G/A) in the human BDNF gene at codon 66 (Val66Met) have been reported to be associated with a predisposition to BD in family-based studies (Rybakowski et al 2006, Green et al 2006). --- Val66Met ---
Furthermore, there are consistent findings in BD regarding the association of Val66Met polymorphism of BDNF gene with prefrontal cognitive impairment, which was recently confirmed in a large sample of bipolar subjects (Rybakowski et al 2006). --- Val66Met ---
In addition, crosssectional studies showed that the polymorphism of BDNF gene (Val66Met) was associated with response to lithium prophylaxis, but findings were not universal (Rybakowski et al 2005, Masui et al 2006). --- Val66Met ---
We also aim to investigate the polymorphism of BDNF gene (Val66Met) and its correlation with BDNF serum levels and treatment response. --- Val66Met ---
This study aims to investigate and compare the intervention effects of combining exercise and cognitive training (either sequentially or simultaneously in a dual-task paradigm) in elderly with mild cognitive impairment. The investigators hypothesize that (1) both sequential and dual-task training can induce greater improvements in the outcome measures than single mode of training; (2) the improvement in cognitive functions and other outcomes may differ between the groups.
The raw score of each subtest will also be transferred to standardized Z scores and summed to represent an index of general cognitive function.. BDNF val66met genotype. --- val66met ---
Saliva samples will be collected at baseline to determine the Brain-Derived Neurotrophic Factor (BDNF) val66met genotype.. Inclusion Criteria: 1. able to follow instruction, 2. clinical dementia rating (CDR) = 0.5 or 1, 3. self- or informant-reported memory or cognitive complaint, and 4. able to perform activities of daily living (Barthel Index ≥ 70). --- val66met ---
Description: The MoCA will be used to assess general cognitive functions. It examines several cognitive domains with a total score of 30.
Measure: Change scores of Montreal Cognitive Assessment (MoCA) Time: baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)Description: The Stroop test will be used to assess the processing speed, inhibition, set-shifting, and selective attention abilities. The participants will be tested under 2 conditions: congruent and incongruent conditions. In the congruent condition, the color ink of a word is consistent with the written color name; while the color ink differs from the written color name under the incongruent condition.
Measure: Change scores of Stroop test Time: baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)Description: The dual-task tests will be assessed to determine the ability for an individual to perform 2 tasks simultaneously. The investigators will assess the dual-task performance during walking and performing box and block test. The results of the dual-task tests will provide information regarding to whether the 2 tasks compete for the same class of neural resources or one of the tasks can be carried out automatically.
Measure: Change scores of Dual-task test Time: baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)Description: The TUG test will be used to assess the mobility and dynamic balance ability. The participants will be required to stand up from a chair, walk 3 meters, turn around, then walk back to the chair, and sit down. The time to complete the TUG test has been shown to be a good indicator to detect potential fallers and frail elderly (Podsiadlo & Richardson, 1991). The test-retest reliability of TUG on individuals with cognitive impairment was excellent (Blankevoort, van Heuvelen, & Scherder, 2013).
Measure: Change scores of Timed up and go (TUG) test Time: baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)Description: Verbal fluency tests will be used to evaluate the semantic memory of the participants. The participants will be instructed to say as many words as possible from a given category (i.e., fruit or animal) in 1 minute. The validity, reliability, and normative performance of verbal fluency tests have been well-established (Harrison, Buxton, Husain, & Wise, 2000).
Measure: Change scores of the Verbal Fluency Test Time: baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)Description: Useful field of view (UFOV) is the visual area over which useful information could be obtained at a quick glance without eye or head movements. This UFOV will be assessed with the BrainHQ program. The UFOV will assess the abilities of visuomotor processing speed, divided attention, and selective attention (Ball, Edwards, & Ross, 2007).
Measure: Change scores of the Useful Field of View (UFOV) Time: baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)Description: The 30 second chair stand test (CST) will be assessed to indicate the strength and endurance level of the lower extremities. The participants will be asked to stand up from a standardized chair and then sit down as many times as possible within 30 seconds. The feasibility and reliability of using CST in people with cognitive impairment have been established to be good (Blankevoort et al., 2013).
Measure: Change scores of the 30 second chair stand test (CST) Time: baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)Description: The Chinese version of the International Physical Activity Questionnaires (IPAQ) is an international measure for health-related physical activity. A short form of IPAQ will be used to assess changes in physical activity before and after intervention in this study. The reliability and validity of IPAQ has been established across 12 countries (Craig et al., 2003).
Measure: Change scores of the Chinese version of the International Physical Activity Questionnaires (IPAQ) Time: baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)Description: Assess activities of daily living
Measure: Change scores of the Barthel Index (BI) Time: baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)Description: Assess activities of daily living.
Measure: Change scores of the Lawton Instrumental Activities of Daily Living Scale Time: baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)Description: Assess activities of daily living.
Measure: Change scores of the Disability Assessment for Dementia (DAD) Time: baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)Description: The Chinese version of QoLAD will be used.
Measure: Change scores of the Quality of Life in Alzheimer's Disease Instrument (QoLAD) Time: baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)Description: The Chinese version of CBI will be used.
Measure: Change scores of the Caregiver Burden Inventory (CBI) Time: baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)Description: The Chinese version of short form GDS will be used.
Measure: Change scores of the Geriatric Depression Scale (GDS) Time: baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)Description: The CIQ measures items relevant to home integration, social integration, and productive activities.
Measure: Change scores of the Community Integration Questionnaire (CIQ) Time: baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)Description: The actigraphy will be placed on the waist for a 3-day period immediately before and after the intervention. The participants will wear the actigraphy during all daily activities except for those that involve water (i.e., showering or swimming).
Measure: Change scores of the ActiGraph GX3 accelerometers Change scores of the ActiGraph Time: baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)Description: The participant will be seated upright in a chair with back support, the knee will be placed in 90-degree flexion and the evaluator will stabilize the thing to eliminate synergistic movements. Participants will be asked to perform a maximal isometric contraction of knee flexion and extension with both lower extremities. The investigators will record the mean value of 3 attempts.
Measure: Change scores of evaluating isometric knee flexors and extensors muscle strength Time: baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)Description: The participant is seated, with the elbow at 90-degree flexion. The investigators will record the mean value of 3 attempts.
Measure: Change scores of using hand dynamometer to measure grip strength of both hand Time: baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)Description: The investigators will use the WMS-III subtests, including Faces Recognition (score range 0-48), Verbal Paired Associates (score range 0-32), Word Lists (0-48), and Spatial Span (0-32) to assess the immediate, delayed, and working memory tests. Higher scores indicated better performance for each subtest. The raw score of each subtest will also be transferred to standardized Z scores and summed to represent an index of general memory function.
Measure: Change scores of Wechsler Memory Scale - Third Edition (WMS-III) Time: baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)Description: The WAIS-III includes tests that evaluate cognitive functions in verbal comprehension, working memory, perceptual organization, and processing speed. The subtests that the investigators will use are the Digit Symbol-Coding (scores range 0-133) and Matrix Reasoning tests (0-26). The raw score of each subtest will also be transferred to standardized Z scores and summed to represent an index of general cognitive function.
Measure: Change scores of Wechsler Adult Intelligence Scale - Third Edition (WAIS-III) Time: baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)Description: Saliva samples will be collected at baseline to determine the Brain-Derived Neurotrophic Factor (BDNF) val66met genotype.
Measure: BDNF val66met genotype Time: baselineSelective biases in attention can be modified by a simple computerized technique: The Attention Bias Modification Task (ABM) pioneered by MacLeod et al. Cognitive biases may be one reason depression recurs, and altering these biases should reduce risk of recurrence. Recently, evidence has supported this hypothesis . The mechanisms by which ABM works are not well understood. More research is needed to explore how altering an implicit attentional bias can lead to changes in subjective mood. One possible explanation is that positive attentional biases are an important component of explicit methods of emotion regulation. The ability to effectively regulate one's emotions is a fundamental component of mental health and this ability is impaired in depression. It has also been shown that recovered depressed people spontaneously show a more dysfunctional pattern of emotion regulation as compared to never depressed controls. Supporting this, growing evidence implicates dysregulation of a medial/orbitofrontal circuit in mood disorders. This circuit includes the orbitofrontal cortex and anterior cingulate cortex, the ventral striatum, the ventral pallidum and medial thalamus. Components of this circuit are reciprocally connected with the amygdala, which is implicated in emotional processing in the healthy brain and dysregulated in depression. Negative emotion processing biases depend on both enhanced "bottom-up" responses to emotionally salient stimuli and reduces "top-down" cognitive control mechanisms, required to suppress responses to emotionally salient but task irrelevant information. Cognitive reappraisal and distancing are common strategies to down- or upregulate emotional responses. Reappraisal is an emotion regulation strategy that involves reinterpretation and changing the way one thinks about an event or stimulus with the goal of changing its affective impact. Distancing is a type of reappraisal that involves creating mental space between oneself and the emotional event in order to see things from a different, less self-focused perspective. It has been shown that distancing is a strategy that people can improve at over time compared to reinterpretation. The neural systems which support the explicit regulation of emotion have previously been characterized and include both lateral- and prefrontal cortex. This frontal activity is predicted to downregulate limbic circuitry involving the amygdala during passive viewing of emotional salient stimuli.
Brain Derived Neurotropic Factor (BDNF) val66met polymorphic variation linked to Brain Derived Neurotropic Factor (BDNF) variation will differentiate between ABMT and neutral AMB placebo as measured by fMRI whole brain BOLD responses.. Serotonergic cumulative genetic score and fMRI. --- val66met ---
Description: Stronger fMRI BOLD response in prefrontal cortical regions in ABMT compared to neutral AMB placebo condition.
Measure: BOLD response in prefrontal cortical regions Time: Two weeks after after ABM-trainingDescription: Lower ABM fMRI BOLD response within the amygdala in ABMT compared to neutral ABM placebo condition.
Measure: BOLD response within the amygdala Time: Two weeks after ABM-trainingDescription: Increased neural integrity as measured by fractional anisotropy values in the uncinate fasciculi (UF) in the active AMBT compared to neutral ABM placebo condition.
Measure: DTI Time: Two weeks after ABM-trainingDescription: Increased integrity within the attentional networks at rest as measured by independent component analysis (ICA) in ABMT compared to neutral ABM training.
Measure: RSFC Time: Two weeks after ABM-trainingDescription: The low expressive variant will be associated with more frontal BOLD activation and lower amygdala activation after ABMT
Measure: 5-HTTLPR + A>G polymorphic variation divided by the triallelic functional "high expressive" versus "low expressive" genotype will moderate the impact from ABMT as measured by whole brain BOLD responses. Time: Two weeks after ABM-trainingDescription: Brain Derived Neurotropic Factor (BDNF) val66met polymorphic variation linked to Brain Derived Neurotropic Factor (BDNF) variation will differentiate between ABMT and neutral AMB placebo as measured by fMRI whole brain BOLD responses.
Measure: BDNF Time: Two week after ABM-trainingDescription: A serotonergic cumulative Genetic score, including (5-HHTLPR, HTR1A 8rs6295) and HTR 2A (rs 6311) polymorphisms will moderate the effects of ABM on fMRI BOLD signal compared to a neutral placebo condition.
Measure: Serotonergic cumulative genetic score and fMRI Time: Two weeks after ABM-trainingDescription: A serotonergic cumulative Genetic score, including (5-HHTLPR, HTR1A 8rs6295) and HTR 2A (rs 6311) polymorphisms will moderate the effects of ABM on structural MRI as measured by total grey matter volume compared to a neutral placebo condition.
Measure: Serotonergic cumulative genetic score and morphompetry Time: Two weeks after ABM-trainingDescription: A serotonergic cumulative Genetic score, including (5-HHTLPR, HTR1A 8rs6295) and HTR 2A (rs 6311) polymorphisms will moderate the effects of ABM on DTI MRI as measured by fractional anisotropy compared to a neutral placebo condition.
Measure: Serotonergic cumulative genetic score and fMRI and DTI Time: Two weeks after ABM-trainingBackground Focal dystonia is a brain disorder. It affects a muscle or muscles in a specific part of the body. Researchers think it may be related to excessive training or practice. They want to know more about how much training might trigger focal dystonia. Objectives: To study why people develop focal dystonia. To study how brain plasticity changes with focal dystonia. Eligibility: People at least 18 years of age with focal dystonia. Healthy volunteers the same age are also needed. Design: Participants will be screened with a physical exam and questions. They may have blood and urine tests. Participants will have up to 3 testing visits. Participants will have small electrodes stuck on the skin on the hands or arms. Muscle activity will be recorded. Participants will have transcranial magnetic stimulation (TMS). A wire coil will be placed onto the scalp. A brief electrical current will pass through the coil. The current will create a magnetic field that affects brain activity. Participants may be asked to tense certain muscles or do simple actions during TMS. A nerve at the wrist will get weak electrical stimulation. The stimulation may be paired with TMS for very short times. Participants will receive repeated magnetic pulses. Participants will receive a total of 150 pulses during a 10-second period. An entire testing visit will last about 3 hours. ...
The Val66Met single nucleotide polymorphism is related to abnormal cortical plasticity. --- Val66Met ---
development of skin adhesive patches for the monitoring and prediction of mental disorders
Brain-derived neurotrophic factor(BDNF) genotyping: Val66Met. --- Val66Met ---
Description: changes of skin conductane level(SCL) and skin conductance response(SCR)
Measure: Electrodermal activity(EDA) Time: baseline, 0.5, 1,2,3 monthsDescription: changes of SDNN, RMSSD and LF/HF ratio
Measure: Heart rate variability Time: baseline, 0.5, 1,2,3 monthsDescription: IL-1α, IL-1β, IL-2, IL-4, IL-6, IL-10, IL-12(p70), IFN-γ, TNF-α
Measure: Cytokines Time: baseline, 0.5, 1,2,3 monthsDescription: serum, plasma, platelet BDNF
Measure: BDNF Time: baseline, 0.5, 1,2,3 monthsDescription: structured interview assessing for DSM-IV Axis I disorders with strong reliability and validity in relation to the Structured Clinical Interview for DSM-IV (SCID-IV)
Measure: MINI plus Time: BaselineDescription: assess current and past Axis I diagnoses
Measure: MINI Suicidality Module Time: baseline, 0.5, 1,2,3 monthsDescription: changes of HAMD-17 total socres
Measure: Hamilton Depression Rating Scale-17(HAMD-17) Time: baseline, 0.5, 1,2,3 monthsDescription: changes of HAMA total scores
Measure: Hamilton Anxiety Rating Scale(HAMA) Time: baseline, 0.5, 1,2,3 monthsDescription: ASI-3 to measure the three most supported AS domains: social (i.e., fear of exhibiting symptoms in public that may elicit embarrassment), cognitive (i.e., fear of losing cognitive control or experiencing concentration difficulties), and physical (i.e., fear that physical sensations are a sign of an immediate physical problem).
Measure: Anxiety Sensitivity Index(ASI) Time: baseline, 0.5, 1,2,3 monthsDescription: The APPQ (Rapee et al., 1995) is a 27-item instrument that is designed to measure interoceptive, agoraphobic, and social situational fear. Subjects respond to each item on a 9-point Likert scale from 0 to 8, according to how much fear they think they would experience in a given situation so that total scores range from 0 to 216.
Measure: APPQ(Albany Panic and Phobia Questionnaire) Time: baseline, 0.5, 1,2,3 monthsDescription: 16-item questionnaire that aims to measure the trait of worry, using Likert rating from 1 (not at all typical of me) to 5 (very typical of me)
Measure: PSWQ(Penn state worry questionnaire) Time: baseline, 0.5, 1,2,3 monthsDescription: emotional, somatic, cognitive, and behavioral stress responses.
Measure: SRI(Stress response Inventory) Time: baseline, 0.5, 1,2,3 monthsDescription: The Perceived Stress Scale (PSS) is the most widely used psychological instrument for measuring the perception of stress. It is a measure of the degree to which situations in one's life are appraised as stressful.
Measure: Perceived Stress Scale(PSS) Time: baseline, 0.5, 1,2,3 monthsDescription: The Barratt Impulsiveness Scale (BIS) is a widely used measure of impulsiveness. It includes 30 items that are scored to yield six first-order factors (attention, motor, self-control, cognitive complexity, perseverance, and cognitive instability impulsiveness) and three second-order factors (attentional, motor, and non-planning impulsiveness).The BIS-11 is a 30-item self-report questionnaire, that is scored to yield a total score, three second-order factors, and six first-order factors.
Measure: Barratt Impulsivity Scale Time: baseline, 0.5, 1,2,3 monthsDescription: The items assess panic frequency, distress during panic, panic-focused anticipatory anxiety, phobic avoidance of situations, phobic avoidance of physical sensations, impairment in work functioning, and impairment in social functioning. The overall assessment is made by a total score, which is calculated by summing the scores for all seven items. The total scores range from 0 to 28.
Measure: Panic disorder severity scale(PDSS) Time: baseline, 0.5, 1,2,3 monthsThe purpose of this study is to determine the treatment effects of sequential combination of aerobic exercise and cognitive training on cognitive function, physiological markers, daily function, physical function, social participation and quality of life in stroke patients with cognitive decline. The investigators hypothesized that: (1) sequential training protocol can improve outcome measures compared to single mode of training; (2) these treatment effects will retain at 6-month follow-up.
Genotyping of the BDNF val66met polymorphism. --- val66met ---
Description: The dual-task tests will be assessed to determine the ability for an individual to perform 2 tasks simultaneously. The investigators will assess the dual-task performance during walking and performing box and block test. The results of the dual-task tests will provide information regarding to whether the 2 tasks compete for the same class of neural resources or one of the tasks can be carried out automatically.
Measure: Change scores of Dual-task test Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)Description: Antioxidative markers will be used to reflect the changes on oxidative stress. In particular, we will be analyzing the total antioxidant capacity (TAC).
Measure: Change scores of Antioxidative marker Time: Baseline, posttest (an expected average of 3 months)Description: HbA1C level will be tested to investigate the relationships between blood glucose level and aerobic exercise.
Measure: Change scores of Glucose indicator Time: Baseline, posttest (an expected average of 3 months)Description: The cholesterol ratio (total cholesterol divided by high-density lipid) will be evaluated to reflect the lipid level in the blood.
Measure: Change scores of Plasma lipid level Time: Baseline, posttest (an expected average of 3 months)Description: We will evaluate isometric knee flexors and extensors muscle strength using handheld dynamometer. Also, we will use hand dynamometer to measure grip strength of the affected and less affected hand while the participant is seated, with the elbow at 90-degree flexion. We will record the mean value of 3 attempts.
Measure: Change scores of muscle strength Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)The purpose of this study is to test the differences between four active treatment conditions for combat-related Post Traumatic Stress Disorder (PTSD): virtual reality exposure therapy (VRE) or prolonged imaginal exposure therapy (PE), both with DCS or placebo, as well as to examine predictors for PTSD and response to treatment in active duty military personnel, veterans, and civilians who served in Iraq and Afghanistan.
heart rate, blood pressure) and/or a genetic polymorphism (BDNF Val66Met) obtained from a saliva sample will be examined. --- Val66Met ---
Description: Clinician Administered PTSD Scale (CAPS) for the DSM-IV [34]. The CAPS-IV is a structured clinical interview designed to assess the 17 DSM-IV PTSD symptoms. CAPS-IV provides categorical ratings of diagnostic status as well as a quantitative index of symptom severity. The CAPS total severity score is based on response to the 17 items that assess the frequency and intensity of current PTSD symptoms. Symptom severity is assessed separately for past month and past week time frames. CAPS-IV range is 0-136, higher scores mean a worse outcome.
Measure: CAPS-IV at the End of Treatment Time: after weekly treatment session 9 (at posttreatment assessment)This is a genetic association study of cognitive impairment in young bipolar disease type I patients without medications in mania, depression, hypomania or mixed states.
Methods: 80 patients with BD type I (SCID DSM-IV), age from 18 to 35 years old, currently on mania, depression, hypomania or mixed state after medication wash out will be submitted to complete neuropsychological evaluation and genotyped for COMT (val158met, rs165599, -287, rs737865), ApoE (epsilon 4) and BDNF (val66met)and 80 healthy controls. --- val158met --- --- val66met ---
Hormonal transitions such as across pregnancy and postpartum may trigger depressive episodes in some women. It is not known why, but estrogen sensitivity may play a critical role. A preclinical human risk model showed that depressive symptoms induced by pharmacological sex-hormone manipulation is linked to increases in serotonin transporter (SERT) brain binding, which lowers serotonergic brain tone. It is currently unknown if these findings translates to women across pre- to postpartum transitions. This longitudinal project studies a group of women who will deliver by planned caesarian, thus permitting the collection of cerebrospinal fluid (csf) containing central markers of serotonergic signaling, at the latest point in pregnancy. The women are followed across late pregnancy, delivery and 6 months postpartum to illuminate relations between sex-hormones, stress-regulation, estradiol sensitivity, csf markers of neurotransmission, serotonin transporter genotype variance, and potential development of subclinical or manifest depressive symptoms. Further, markers of relevance for the infant brain development and stress-regulation will be obtained from placenta tissue and umbilical cord blood. A subgroup of 70 women will participate in a brain imaging program early postpartum (week 3-5), which includes an evaluation of brain activity and structure and in vivo molecular brain imaging serotonergic markers. Thus, serotonergic markers in csf can be combined with postpartum molecular brain imaging of key features of serotonin signaling. Women in the imaging program are selected based on variation in their level of mental distress immediately postpartum (day 2-5). The study's main hypothesis is that women with high-expressing SERT genotypes are more sensitive to peripartum hormonal transition in terms of changes in serotonergic tone and emergence of depressive symptoms and that such an association will be stronger in the presence of candidate gene transcript biomarkers of oestrogen sensitivity. A further hypothesis is that in vivo molecular brain imaging and csf based serotonergic markers will be associated with depressive symptoms both early and later postpartum. Ideally, this project will provide a rationale for future targeted prevention and/or treatment of perinatal depression in women at high risk, which holds grand potential to protect not only mother but also infant brain health long-term.
BDNF val66met (rs6265) status, binary variable, i.e. "val/val" versus "met-carrier" status. --- val66met ---
Description: Edinburgh Postnatal Depression Scale. Score range: 0-30. Higher scores indicate more symptoms of postpartum depression. Total group
Measure: Depressive symptoms Time: Week 3-6 postpartumDescription: Score on the Hamilton 17-item depression scale. Score range: 0-52. Higher scores indicate more depressive symptoms. Assessed in imaging group
Measure: Depressive symptoms Time: Week 3-6 postpartumDescription: 116 a priori defined gene transcripts, which where differentially expressed in third trimester of women who later developed perinatal depression with postpartum onset relative to pregnant women who did not and to other depressed (reference Mehta et al, 2014, Psychological Medicine) and confirmed to be coupled to estrogen fluctuations (Mehtaet al. 2018 British Journal of Psychiatry) will be evaluated in the total group. Also DNA methylation of the genes of these transcripts will be determined and analysed in terms of their predictive value (above chance) for perinatal depression.
Measure: Gene transcript and DNA methylation markers of estrogen sensitivity Time: Prior to caesarean sectionDescription: Latent variable construct of brain 5-HT4R level based on quantification of 5-HT4R binding from 11C-SB207145 positron emission tomography in primary volumes of interest; neocortex, nucleus caudatus, putamen and hippocampus. Assessed in imaging group.
Measure: Cerebral serotonin 4 receptor binding postpartum Time: Week 3-6 postpartumDescription: Assessed in total group
Measure: CSF levels of GABA Time: On day of caesarean sectionDescription: Assessed in total group
Measure: CSF levels of serotonin metabolite (5-HIAA) Time: On day of caesarean sectionDescription: Cortisol awakening response, area under the curve with respect to baseline from 0 to 60 minutes from awakening.
Measure: Cortisol awakening response Time: Week 3-6 postpartumDescription: Provides an estimate of cortisol exposure up to 6 months prior to delivery, total group
Measure: Hair cortisol level mothers Time: On day of caesarean section.Description: Provides an estimate of fetal cortisol exposure, infants from total group
Measure: Hair cortisol level newborns Time: Day 0-5 postpartum.Description: Hippocampal brain volume (including hippocampus) from structural MRI, imaging group.
Measure: Hippocampal volumes Time: Week 3-6 postpartum.Description: fMRI (BOLD response) based assessment of brain activity in response to reward, relative to non-reward, stimuli. Assessed in imaging cohort
Measure: functional MRI response to reward Time: Week 3-6 postpartum.Description: rsfMRI based spontaneous co-fluctuations in low frequency BOLD signal, (functional connectivity). Assessed with rsfMRI scan in the resting state, i.e. non-goal oriented spontaneous thought and awake. Assessed in imaging group.
Measure: Resting state functional connectivity MRI Time: Week 3-6 postpartumDescription: Change in epigenetic SERT status from late pregnancy to postpartum week 3-6.
Measure: Change in epigenetic SERT status Time: From just before delivery to 3-6 weeks postpartumDescription: Composite measure of hsCRP, TNF-α, IL-6, IL-18 and IL-10 levels, total group
Measure: Concentration of inflammatory markers, i.e hsCRP and immunoactive cytokines, in peripheral blood Time: At week 3-6Description: fMRI (BOLD response) based assessment of brain activity to emotionally salient, relative to neutral, stimuli. Assessed in imaging cohort.
Measure: functional MRI response to emotional faces Time: Week 3-6 postpartum.Description: Score on the Hamilton 17-item depression scale. Score range: 0-52. Higher scores indicate more depressive symptoms. Assessed in imaging group
Measure: Depressive symptoms Time: Day 3-5 postpartumDescription: Score on the Hamilton 17-item depression scale. Score range: 0-52. Higher scores indicate more depressive symptoms. Assessed in imaging group
Measure: Depressive symptoms Time: Week 12 postpartumDescription: Edinburgh Postnatal Depression Scale. Score range: 0-30. Higher scores indicate more symptoms of postpartum depression. Assessed in total group
Measure: Depressive symptoms Time: Day 3-5 postpartumDescription: Edinburgh Postnatal Depression Scale. Score range: 0-30. Higher scores indicate more symptoms of postpartum depression. Assessed in all
Measure: Depressive symptoms Time: 6 months postpartumDescription: Assessed in total group
Measure: CSF levels of serotonin Time: On day of caesarean sectionDescription: Assessed in total group
Measure: CSF levels of dopamine metabolites Time: On day of caesarean sectionDescription: Assessed in total group
Measure: CSF levels of noradrenaline metabolites Time: On day of caesarean sectionDescription: Composite measure of IFN-c, IFN-alfa TNF-alfa og IL-6, in total group
Measure: CSF levels of inflammatory markers Time: On day of caesarean sectionDescription: Estradiol level in peripheral blood, total group
Measure: Estradiol level Time: Prior to caesarean section.Description: Estradiol level peripheral blood, total group
Measure: Estradiol level Time: At week 3-6 postpartum.Description: Estradiol change pre- to postpartum, peripheral blood total group
Measure: Change in estradiol level Time: From baseline (caesarean section to week 3-6 postpartum)Description: Progesterone level in peripheral blood
Measure: Progesterone level Time: Prior to caesarean section.Description: Progesterone level in peripheral blood
Measure: Progesterone level Time: At week 3-6 postpartum.Description: Progesterone change pre- to postpartum, peripheral blood total group
Measure: Change in progesterone level Time: From baseline (caesarean section to week 3-6 postpartum)Description: Allopregnanolone level in peripheral blood
Measure: Allopregnanolone level Time: Prior to caesarean section.Description: Allopregnanolone level in peripheral blood
Measure: Allopregnanolone level Time: At week 3-6 postpartum.Description: Change in allopregnanolone level in peripheral blood
Measure: Change in allopregnanolone level Time: From baseline (caesarean section to week 3-6 postpartum)Description: Cortisol change pre- to postpartum, peripheral blood total group
Measure: Change in cortisol level Time: From baseline (caesarean section to week 3-6 postpartum)Description: Cortisol awakening response, area under the curve with respect to baseline from 0 to 60 minutes from awakening.
Measure: Cortisol awakening response Time: Week 12 postpartumDescription: Cortisol awakening response, area under the curve with respect to baseline from 0 to 60 minutes from awakening.
Measure: Cortisol awakening response Time: Prior to caesarean sectionDescription: Change in cortisol awakening response, from caesarean section to 3-6 weeks postpartum.
Measure: Change in cortisol awakening response Time: ´From baseline (caesarean section to week 3-6 postpartum)Description: Methylation status for the SERT gene, total group
Measure: DNA methylation of the SERT gene Time: Prior to caesarean sectionDescription: DNA Methylation status for the SERT gene, total group
Measure: DNA methylation of the SERT gene Time: Week 3-6 postpartumDescription: Methylation status for the FK506-binding protein 51 (FKBP5) gene, total group
Measure: DNA methylation of the FK506-binding protein 51 (FKBP5) gene Time: Prior to caesarean section.Description: Methylation status for the FK506-binding protein 51 (FKBP5) gene, total group
Measure: DNA methylation of the FK506-binding protein 51 (FKBP5) gene Time: Week 3-6 postpartumDescription: Change in methylation status for the FK506-binding protein 51 (FKBP5) gene from late pregnancy to postpartum week 3-6.
Measure: Change in DNA methylation of the FK506-binding protein 51 (FKBP5) gene Time: From baseline (caesarean section to week 3-6 postpartum)Description: Methylation status for the glucocorticoid receptor gene, total group
Measure: DNA methylation of the glucocorticoid receptor gene Time: Prior to caesarean section.Description: Methylation status for the glucocorticoid receptor gene, total group
Measure: DNA methylation of the glucocorticoid receptor gene Time: Week 3-6 postpartumDescription: Change in methylation status for the glucocorticoid receptor gene from late pregnancy to postpartum week 3-6.
Measure: Change in DNA methylation of the glucocorticoid receptor gene Time: From baseline (caesarean section to week 3-6 postpartum)Description: Methylation status for the COMT gene, total group
Measure: DNA methylation of the COMT gene Time: Prior to caesarean section.Description: Methylation status for the COMT gene, total group
Measure: DNA methylation of the COMT gene Time: Week 3-6 postpartumDescription: Change in methylation status for the COMT gene from just before delivery to 3-6 weeks postpartum
Measure: Change in DNA methylation of the COMT gene Time: From baseline (caesarean section to week 3-6 postpartum)Description: Methylation status for the MAO-A gene, total group
Measure: DNA methylation of the MAO-A gene Time: Prior to caesarean section.Description: Change in methylation status for the MAO-A gene, total group
Measure: Change in DNA methylation of the MAO-A gene Time: From baseline (caesarean section to week 3-6 postpartum)Description: Methylation status for the MAO-A gene, total group
Measure: DNA methylation of the MAO-A gene Time: Week 3-6 postpartumDescription: Methylation status for the oxytocin receptor gene, total group
Measure: DNA methylation of the oxytocin receptor gene Time: Prior to caesarean section.Description: Methylation status for the oxytocin receptor gene, total group
Measure: DNA methylation of the oxytocin receptor gene Time: Week 3-6 postpartumDescription: Change in methylation status for the oxytocin receptor gene, total group
Measure: Change in DNA methylation of the oxytocin receptor gene Time: From baseline (caesarean section to week 3-6 postpartum)Description: Methylation status for the oxytocin gene, total group
Measure: DNA methylation of the oxytocin gene Time: Prior to caesarean section.Description: Methylation status for the oxytocin gene, total group
Measure: DNA methylation of the oxytocin gene Time: Week 3-6 postpartumDescription: Change methylation status for the oxytocin gene, total group
Measure: Change in DNA methylation of the oxytocin gene Time: From baseline (caesarean section to week 3-6 postpartum)Description: Composite measure of hsCRP, TNF-α, IL-6, IL-18 and IL-10 levels, total group
Measure: Systemic inflammation peripheral blood hsCRP and immunoactive cytokines Time: Prior to caesarean section.Description: Change in composite measure of hsCRP, TNF-α, IL-6, IL-18 and IL-10 levels, total group
Measure: Change in systemic inflammation peripheral blood hsCRP and immunoactive cytokines Time: From baseline (caesarean section to week 3-6 postpartumDescription: Family History Assessment Module (OS-FHAM). Number of first degree relatives with a history of depressive episodes or bipolar disorder. Total group.
Measure: Self reported family history of mood disorders Time: Day 3-5 postpartum or beforeDescription: Barratt Impulsiveness Scale (BIS-11), self-reported. Range: 30-120. Total group.
Measure: Self reported impulsiveness score Time: Day 3-5 postpartum or beforeDescription: NEO-PI-R - Revised NEO Personality Inventory, self-reported. Participants may score 20-80 for each of the personality traits: openness, conscientiousness, extraversion, agreeableness, and neuroticism. The higher the score, the more prominent is the personality trait. Total group.
Measure: Self reported Neuroticism score from NEO personality questionnaire Time: Day 3-5 postpartum or beforeDescription: Parental bonding instrument (PBI), both parents, self-reported. Total group.
Measure: Self reported parental bonding quality Time: Day 3-5 postpartum or beforeDescription: Perceived Stress Scale (PSS), range 0-40, a score of 0 indicates no perceived stress. Total group.
Measure: Self-reported perceived stress Time: Day 3-5 postpartumDescription: Perceived Stress Scale (PSS), range 0-40, a score of 0 indicates no perceived stress. Total group.
Measure: Self-reported perceived stress Time: Week 3-6 postpartumDescription: Change in Perceived Stress Scale (PSS), range 0-40, a score of 0 indicates no perceived stress. Total group.
Measure: Change in self-reported perceived stress Time: Change from day 3-5 to week 3-6 postpartumDescription: Snaith-Hamilton Pleasure Scale (SHAPS), range 0-14, a score of 0 indicates no self-reported anhedonia. Total group.
Measure: Self-reported anhedonia Time: Day 3-5 postpartumDescription: Snaith-Hamilton Pleasure Scale (SHAPS), range 0-14, a score of 0 indicates no self-reported anhedonia. Total group.
Measure: Self-reported anhedonia Time: Week 3-6 postpartumDescription: Change in Snaith-Hamilton Pleasure Scale (SHAPS) score, range 0-14, a score of 0 indicates no self-reported anhedonia. Total group.
Measure: Change in self-reported anhedonia Time: Change from day 3-5 to week 3-6 postpartumDescription: Rumination Response Scale (RRS), range 22-88, a score of 22 indicates no ruminative symptoms. Total group.
Measure: Self-reported rumination Time: Day 3-5 postpartumDescription: Rumination Response Scale (RRS), range 22-88, a score of 22 indicates no ruminative symptoms. Total group.
Measure: Self-reported rumination Time: Week 3-6 postpartumDescription: Change in Rumination Response Scale (RRS) score, range 22-88, a score of 22 indicates no ruminative symptoms. Total group.
Measure: Change in elf-reported rumination Time: Change from day 3-5 to week 3-6 postpartumDescription: Profile of Mood States (POMS), range 0-260, a score of 0 indicates no mood disturbance. Total group.
Measure: Self-reported mood Time: Day 3-5 postpartumDescription: Profile of Mood States (POMS), range 0-260, a score of 0 indicates no mood disturbance. Total group.
Measure: Self-reported mood Time: Week 3-6 postpartumDescription: Change in Profile of Mood States (POMS) score, range 0-260, a score of 0 indicates no mood disturbance. Total group.
Measure: Change in self-reported mood Time: Change from day 3-5 to week 3-6 postpartumDescription: Pittsburgh Sleep Quality Index (PSQI), range 0-21, a score of 0 indicates a healthy sleep quality. Total group.
Measure: Self-reported sleep quality Time: Day 3-5 postpartumDescription: Pittsburgh Sleep Quality Index (PSQI), range 0-21, a score of 0 indicates a healthy sleep quality. Total group.
Measure: Self-reported sleep quality Time: Week 3-6 postpartumDescription: Change in Pittsburgh Sleep Quality Index (PSQI), range 0-21, a score of 0 indicates a healthy sleep quality. Total group.
Measure: Change in self-reported sleep quality Time: Change from day 3-5 to week 3-6 postpartumDescription: Brief symptom Inventory-53 item (BSI-53), range 0-212, increasing score means worsening of symptoms.Total group.
Measure: Self-reported psychiatric symptoms Time: Day 3-5 postpartumDescription: Brief symptom Inventory-53 item (BSI-53), range 0-212, increasing score means worsening of symptoms.Total group.
Measure: Self-reported psychiatric symptoms Time: Week 3-6 postpartumDescription: Change in Brief symptom Inventory-53 item (BSI-53) score, range 0-212, increasing score means worsening of symptoms.Total group.
Measure: Change in self-reported psychiatric symptoms Time: Change from day 3-5 to week 3-6 postpartumDescription: WHO-5 well-being index, range 0-100, low score means less well-being. Total group.
Measure: Self-reported well-being Time: Day 3-5 postpartumDescription: WHO-5 well-being index, range 0-100, low score means less well-being. Total group.
Measure: Self-reported well-being Time: Week 3-6 postpartumDescription: Change in WHO-5 well-being index, range 0-100, low score means less well-being. Total group.
Measure: Change in self-reported well-being Time: Change from day 3-5 to week 3-6 postpartumDescription: State Trait Anxiety Inventory (STAI-AD-D), state and trait subscales each have a range of 20-80, 20 means no anxiety. Total group.
Measure: Self-reported anxiety Time: Day 3-5 postpartumDescription: State Trait Anxiety Inventory (STAI-AD-D), state subscale range 20-80, 20 means no anxiety. Total group.
Measure: Self-reported anxiety Time: Week 3-6 postpartumDescription: Change in State Trait Anxiety Inventory (STAI-AD-D) score, state subscale range 20-80, 20 means no anxiety. Total group.
Measure: Change in self-reported anxiety Time: Change from day 3-5 to week 3-6 postpartumDescription: Obsessive-Compulsive Inventory (OCI) score, self-reported, range 0-72, higher scores indicate more symptoms. Total group.
Measure: Self-reported obsessive and compulsive symptoms Time: Day 3-5Description: Obsessive-Compulsive Inventory (OCI) score, self-reported, range 0-72, higher scores indicate more symptoms. Total group.
Measure: Self-reported obsessive and compulsive symptoms Time: Week 3-6 postpartumDescription: Change in Obsessive-Compulsive Inventory (OCI) score, self-reported, range 0-72, higher scores indicate more symptoms. Total group.
Measure: Change in self-reported obsessive and compulsive symptoms Time: Change from day 3-5 to week 3-6 postpartumDescription: Performance on Simple Reaction Time, in imaging cohort.
Measure: Performance on Simple Reaction Time Time: Week 3-6 postpartumDescription: Gray matter brain volume prefrontal cortex and anterior cingulate cortex
Measure: Gray matter brain volume prefrontal cortex and anterior cingulate cortex Time: At week 3-6 postpartumDescription: Composite measure of serotonin, tryptophan og tryptofan hydroxylase levels relative to 5-HIAA, in placenta sample. Infants from total group
Measure: Serotonergic turnover in placenta Time: At delivery.Description: 11-beta-hydroxysteroid dehydrogenase type 2 activity in placenta. Infants from total group
Measure: 11-beta-hydroxysteroid dehydrogenase type 2 activity in placenta Time: At deliveryDescription: Composite measure of methylation status for the FKBP5, glucocorticoid receptor, 11-beta hydroxysteroid dehydrogenase type 2 genes. Infants from total group
Measure: Methylation status of genes relevant for stress-hormone regulation in placenta Time: At deliveryDescription: Composite measure of the methylation status for monoamine oxidase, serotonin receptor and serotonin transporter genes. Infants from total group
Measure: Methylation status of genes related to serotonergic signaling in placenta Time: At deliveryDescription: Composite measure of methylation status and gene transcript profiles of Glucocorticoid receptor, FKBP5, oxytocin and oxytocin receptors, Brain-derived neurotrophic factor (BDNF) genes. Assessed in blood from umbilical cord blood sample from infants, total group.
Measure: Methylation status and gene transcript profiles of relevance for early brain development and stress regulation in newborn infants Time: At delivery.Description: val158met (rs4680) status, binary variable, i.e. "val/val, val/met" vs "met/met" variants
Measure: COMT-genotype (rs4680) variant, i.e met/met vs other polymorphisms Time: Prior to caesarean section.Description: BDNF val66met (rs6265) status, binary variable, i.e. "val/val" versus "met-carrier" status
Measure: BDNF genotype (rs6265) status, i.e. val/val versus met-carrier variants Time: Prior to caesarean section.Description: 5-HTTLPR genotype status (binary), i.e. high-expressing LALA vs low-expressing (S or LG) variants, based on SLC6A4, i.e. L or S variants, and further subtyping on rs25531 haplotype L(A)L(A) vs LGLA, LGLG or variants containing as S as specified above.
Measure: 5-HTT genotype status, i.e LALA vs low-expressing (S or LG) variants Time: Prior to caesarean section.Description: In house interview based on Kennerley Maternity Blues Questionnaire, range: 0-28, higher score indicates more severe postpartum blues symptoms. High blues score is associated with greater risk for perinatal depression at week 3-6.
Measure: Postpartum blues symptoms Time: Day 3-5 postpartum.Description: In house interview based on Stein's Maternity Blues Scale, range 0-26. High blues score is associated with greater risk for perinatal depression at week 3-6.
Measure: Postpartum blues symptoms Time: Day 3-5 postpartum.This study will evaluate the feasibility of dual tDCS to improve arm motor function in chronic stroke patients. In addition it will collect pilot data on the blood biomarkers associated with treatment effect.
Since in animal models VEGF and BDNF have a complimentary role, VEGF polymorphism may explain some of the variability in strength of association between BDNF polymorphism Val66Met and recovery. --- Val66Met ---
Description: any adverse events that might be related to study procedures
Measure: adverse events Time: enrollment to 3 month followupDescription: Upper extremity motor impairment scale. Scale ranges from 0 (worst, can not perform any tasks) to 66 ( performs all tasks fully).
Measure: Upper extremity Fugl-Meyer score Time: change between before and 3 months follow-upDescription: Timed performance of 15 functional upper extremity tasks, 0-120 seconds, and 2 strength measures. WMFT time measurements are calculated as the arithmetic mean of rate of performance, where we calculate "how many times would a person have completed the task, had he or she been performing it continuously for 60 seconds". Therefore the results have a minimum score of 0, where the subject could not perform any of the tasks, and no pre-defined maximum score, the higher the rate score the faster the subject was able to perform the tasks. ( see Hodics et al.,2013)
Measure: Wolf Motor Function Test Time: change between before and at 3 months follow-upThe overall goal of the proposed study is to evaluate the effects of an 8-week aerobic exercise program on cognition and determine the relationship between cognitive improvements and Transcranial Magnetic Stimulation (TMS) neuroplasticity. The investigators will also explore the effect modification of BDNF levels and BDNF allelic status, and APOE4 status on cognitive response after exercise.
Genetic testing will be performed to assess for brain-derived neurotrophic factor (BDNF) Val66Met polymorphism.. Allelic Status APOE. --- Val66Met ---
Description: An index of the duration of the Theta-Burst Stimulation (TBS) induced modulation of corticospinal excitability (the time-point at which the normalized mean Motor Evoked Potential (MEP) amplitude returns to baseline values) will be defined for each participant.
Measure: Change in TMS Plasticity Measures Time: baseline and after 8 weeks of exerciseDescription: Cognitive performance will be assessed using a neuropsychological test battery in executive function, processing speed, learning, and language.
Measure: Change in Cognitive Performance Time: baseline and after 8 weeks of exerciseDescription: Blood samples will be collected for BDNF levels.
Measure: Changes in BDNF Levels Time: baseline and after 8 weeks of exerciseDescription: A maximal treadmill test will be performed to determine maximal oxygen uptake (VO2) as a measure of aerobic capacity.
Measure: Change in Aerobic Capacity (Cardiovascular Fitness) Time: baseline and after 8 weeks of exerciseDescription: Genetic testing will be performed to assess for brain-derived neurotrophic factor (BDNF) Val66Met polymorphism.
Measure: Allelic Status BDNF Time: baselineDescription: Genetic testing will be performed to assess for the presence of apolipoprotein-E (APOE) e4 allele.
Measure: Allelic Status APOE Time: baselineThe purposes of this pilot research study are 1. To begin to test if two different types of physical therapy might have different results in children and adolescents who have had a prior stroke, and 2. To determine if either type of physical therapy causes changes in the brain signals that control leg muscles. All participants will receive physical therapy 3 times per week for 8 weeks. Half of the participants will receive typical physical therapy, such as walking practice, muscle strengthening, and balance training. Half of the participants will receive asymmetrical gait training physical therapy, which uses new technology to train each leg differently during walking practice. After enrolling, participants will be randomly assigned to the type of therapy. Measurements will be taken before, during, and after the 8 weeks of physical therapy. These include walking tests to measure symmetry, walking speed and daily step activity, and brain tests to measure the strength of the signals from the brain to the leg muscles. One blood test is also taken to identify if certain genetic factors affect how each child responds to the physical therapy.
We will also establish a genetic database to identify the presence or absence of two genetic variants [Apolipoprotein E (ApoE Є4) and val66met Brain-derived neurotropic factor (BDNF) polymorphisms] associated with decreased potential for neuroplasticity for planning future investigations. --- val66met ---
Several animal and human epidemiologic studies have provided evidence that exercise may be neuroprotective in Parkinson's disease (PD). Exercise may forestall diagnosis and, in the case of those who have already been diagnosed with PD, it may slow the observed neurodegeneration. Unfortunately, because this line of research is in early stages, there is little evidence to indicate what biological mechanisms underlie the neuroprotection that is conferred with exercise. Toward this end, it is possible that an interaction between endogenous antioxidant enzymes, inflammatory processes, and reactive oxygen species may be associated with exercise improvements in PD. One of the most common reasons for premature death in PD is falls. Several meta-analyses have concluded that exercise training programs focused on balance and/or strength training are effective at improving aspects of balance. Taken together, the current body of evidence suggests that exercise may be neuroprotective and balance/strength training may decrease the likelihood of a fall. The combination of these efficacious treatment modalities (exercise and balance/strength training) in a comprehensive treatment approach to improve PD symptoms and balance has been previously reported at relatively mild or moderate exercise intensities. Because recent research has suggested that patients with PD may benefit more from more physically intense programs, we are proposing a more aggressive approach with regard to exercise intensity and frequency in the present trial. The primary purpose of this study is to determine the feasibility and safety of a high intensity exercise approach to PD. A secondary purpose is to determine the trajectory of change in outcomes over the duration of the trial from a high intensity fall prevention program. It is hoped that a signal of efficacy will allow this trial to progress to a comparative effectiveness trial. An important innovative design element is collecting biological assays to better understand the mechanism underlying the anticipated clinical improvements. Aim 1 is to test the feasibility of a high-intensity exercise and fall prevention boot camp (HIBC) in patients with PD by analyzing adherence and whether they achieve minimum Centers for Disease Control exercise standards (150 min/wk moderate level aerobic exercise; strengthening at least two times per week) for the duration of the trial. Aim 2 is to determine if participation in an 8-week HIBC under the direction of a physical therapist is safe for individuals with PD. Secondary Aim 3 is to determine if participation in an 8-week HIBC will produce a signal of efficacy for several physical outcomes: falls per physical activity ratio, balance efficacy, motor activity, fatigue, muscle strength, bone health, cognition/mood, and quality of life. Secondary Aim 4 is to determine if participation in an 8-week HIBC will produce a signal of efficacy for biological outcomes, anti-inflammatory cytokines and anti-oxidant enzymes. An additional exploratory aim will be an analysis of BDNF val66val, val66met, met66met polymorphisms to determine if there is a differential response to exercise. This trial is innovative because it utilizes a high intensity comprehensive exercise treatment approach (aerobic exercise, strengthening, and balance training). To our knowledge, there have been no trials of individuals with PD who have participated in a trial of this intensity in a group "boot camp" setting. Another innovative design element is the use of three novel assessments: biological assays of pro- and anti-inflammatory cytokines, endogenous anti-oxidant enzymes and a novel assessment of falls (falls per physical activity ratio). Participants will be randomly assigned into either an 8-week HIBC group or an 8-week usual care control group (standard, low intensity group therapy class) under the direction of physical therapists. Each group will have 15 participants with a 1:5 patient-to-therapist ratio. The HIBC will be 1.5 hours daily, Monday through Friday. Participants will be required to attend 3 out of the 5 days. The protocol of the HIBC will include the following exercise components: A. 30 minutes of moderate-high intensity aerobic exercise; B. 15 minutes of strengthening the major muscle groups; C. 15 minutes of balance training; and, D. 15 minutes of interspersed rest and stretching. Participants will rotate through these four exercise components. Participants will have one baseline test and assessments at the 2-week, 4 week, 8-week, and 6-month points. Outcomes of the primary aims (Aim 1 and Aim 2) will be frequency counts of participation, adverse events, and compliance with exercise. The outcomes for the secondary aims will include measures of balance and falls, physical capacity, fatigue, exercise/physical activity behavior, and biological assays.
An additional exploratory aim will be an analysis of BDNF val66val, val66met, met66met polymorphisms to determine if there is a differential response to exercise. --- val66met ---
Description: The number of participants that attend and participate in the treatment at least 3 times per week for 8 weeks.
Measure: Frequency feasibility Time: After completion of the 8 week trialDescription: The number of participants that complete at least 150 minutes per week of moderate intensity exercise (70%+ of their estimated HR maximum). This will be ascertained using heart rate monitors.
Measure: Aerobic feasibility Time: At the end of the 8 week trialDescription: The number of participants that participate in strengthening exercises that incorporates all the major muscle groups at least two days per week.
Measure: Strength feasibility Time: At the end of the 8 week trialDescription: Drop-out rate and reason for drop-out will be tracked.
Measure: Compliance Time: At the end of the 8 week trialDescription: Exercise-related adverse events (e.g., strains/sprains, cardiovascular events).
Measure: Safety Time: Ongoing throughout the 8 week trialDescription: The Intrinsic Motivation Inventory (IMI) will be used to gather information about motivation.
Measure: Motivation Time: At 8 weeksDescription: Falls and fall injuries in and out of boot camp will be collected.
Measure: Falls Time: At the end of the 8 week trialDescription: Falls will be tracked for 6 months after the boot camp using a falls diary. A member of the research team will call each month to interview participants about their falls. We will assess falls/fall injuries per physical activity ratio during the 6 month period following the trial and time to a fall/fall injury after the trial.
Measure: Falls Time: up to 6 monthsDescription: Physical activity will be assessed using the Physical Activity Monitoring System (PAMsys).
Measure: Motor activity Time: up to 6 monthsDescription: Fatigue will be assessed using the Parkinson Fatigue Scale (PFS).
Measure: Fatigue Time: up to 6 monthsDescription: This will be assessed functionally using the 30 second Sit-To-Stand Test (30STS) for muscle strength.
Measure: Strength Time: up to 6 monthsDescription: Cognition will be assessed using the Montreal Cognitive Assessment (MoCA).
Measure: Cognition Time: up to 6 monthsDescription: This will be assessed by using a measure of disease-specific quality of life (Parkinson's Disease Questionnaire-39 (PDQ39)).
Measure: Quality of life Time: up to 6 monthsDescription: All participants will track their participation in exercise and physical activity using an exercise diary for 6 months following the boot camp. Participants will be called monthly to reinforce completion of the exercise diary.
Measure: Long term behavioral change Time: up to 6 monthsDescription: Performance-based balance tasks.
Measure: mini-Balance Evaluation Systems Test (mini-BESTest) Time: up to 6 monthsDescription: Activities Specific Balance Confidence Scale (ABC)
Measure: Falls self-efficacy Time: up to 6 monthsDescription: Self-report measurement tool: Falls Efficacy Scale (FES)
Measure: Fall Efficacy Time: Up to 6 monthsDescription: Self-report of fall catastrophization: Catastrophization about Falls Questionnaire (CAFS)
Measure: Fall catastrophization Time: Up to 6 monthsDescription: Self-report measure physical activity: International Physical Activity Questionnaire (IPAQ)
Measure: Physical activity Time: Up to 6 monthsDescription: Unified Parkinson's Disease Rating Scale motor subscale (UDPRS III)
Measure: Motor symptoms Time: Up to 6 monthsDescription: Self-report scale of avoidance behavior due to a fear of falling: Fear of Falls Avoidance Behavior Questionnaire (FFABQ)
Measure: Fear of falling Time: Up to 6 monthsDescription: Endurance will be assessed using the 6 Minute Walk Test (6MWT).
Measure: Endurance Time: Up to 6 monthsDescription: Bone health will be measured using bone mineral densiometry (BMD).
Measure: bone health Time: up to 6 monthsDescription: Mood will be measured using the Beck Depression Inventory.
Measure: Mood Time: up to 6 monthsDescription: Catalase concentrations from blood will be quantified utilizing enzyme-linked immunosorbent assays.
Measure: Catalase Time: Up to 6 monthsDescription: Cytokine (TNFα, IL-6, IL-10) concentrations from blood will be quantified utilizing enzyme-linked immunosorbent assays.
Measure: Cytokines Time: Up to 6 monthsDescription: Circulating BDNF concentrations from blood will be quantified utilizing enzyme-linked immunosorbent assays.
Measure: BDNF Time: up to 6 monthsAtopic dermatitis (AD) and psoriasis (PS) are chronic, relapsing dermatological disorders with a high rate of psychiatric co-morbid pathology represented with depression. Brain Derived Neurotrophic Factor (BDNF) belongs to the neurotrophin family and widely studied in pathophysiology of psychiatric and dermatological disorders. A biological stress response system by altered hypothalamic-pituitary-adrenal (HPA) axis as well hypothalamic-pituitary-gonadal (HPG) axis may contribute to dermatoses and psychiatric disorders development. Various factors including gender, genetic, psychological stress, socioeconomic factors also affect the course of dermatoses. A 10-week, case-control study evaluate clinical, psychological and biochemical parameters in AD and PS patients, and healthy control volunteers (HC) depending on gender and BDNF rs6265 gene polymorphism. All parameters are evaluated twice: at disease exacerbation (study baseline) and week 10. The following methods are conducted: assessment of dermatological status, using Scoring of Atopic Dermatitis (SCORAD) and Psoriasis Area and Severity Index (PASI); assessment of depression and anxiety according to DSM-V criteria and with Hamilton Depression Rating Scale (HAM-D) and with Hamilton Anxiety Rating Scale (HAM-A); analysis of serum BDNF (ng/ml), cortisol (nmol/L), testosterone (ng/dL) and IgE levels (IU/ml, AD only); DNA extraction and genotyping of BDNF variants.The study will last during 4-5 months.
DNA extraction and genotyping the BDNF rs6265 (Val66Met) gene polymorphism in AD, PS and HC. --- Val66Met ---
Description: Assessment of atopic dermatitis severity is conducted using Scoring of Atopic Dermatitis (SCORAD) index. SCORAD index formula is: A/5 + 7B/2 + C. In this formula A is defined as the extent (0-100), B is defined as the intensity (0-18) and C is defined as the subjective symptoms (0-20). The maximum SCORAD score is 103. SCORAD <23 - mild AD; SCORAD from 23 to 63 - moderate AD; SCORAD> 63 - severe AD.
Measure: Assessment of change in the severity of atopic dermatitis after conventional treatment from study onset (baseline) at week 10 Time: At disease onset (study baseline) and at week 10Description: Assessment of the psoriasis severity is conducted using Psoriasis Area and Severity Index (PASI). The patient's body is divided into four sections (head (H) (10% of a person's skin); arms (A) (20%); trunk (T) (30%); legs (L) (40%)). The percent of skin lesions of each area is assessed as follows: 0 (0% of involved area); 1 (< 10%); 2 (10-29%); 3 (30-49%); 4 (50-69%); 5 (70-89%); 6 (90-100%). Further, for each region, the intensity of 3 clinical signs is evaluated - redness, thickness and scaling and assessed as follows: 0 - no lesions,1 - easy, 2 - moderate, 3 - severe, 4 - very severe. The sum of all three severity parameters is calculated for each section, multiplied by the area score for that area and multiplied by weight of respective section (0.1 for head, 0.2 for arms, 0.3 for body, 0.4 for legs). PASI range is from 0 (no disease) to 72 (maximum disease). The severity of psoriasis is assessed as follows: PASI <20 - mild; PASI from 20 to 50 - moderate; PASI> 50 - severe
Measure: Assessment of change in the severity of psoriasis after conventional treatment from study onset (baseline) at week 10 Time: At disease onset (study baseline) and at week 10Description: Depression is assessed according to Diagnostic and Statistical Manual of Mental Disorders (DSM) -V criteria and with Hamilton Depression Rating Scale (HAM-D) using the following ranges: absence, ≤7; mild, 8-16; moderate, 17-27; severe, ≤28
Measure: Assessment of change in the severity of depression in atopic dermatitis and psoriasis patients after conventional treatment from study onset (baseline) at week 10 Time: At disease onset (study baseline) and week 10Description: Depression is assessed according to Diagnostic and Statistical Manual of Mental Disorders (DSM) -V criteria and with Hamilton Depression Rating Scale (HAM-D) using the following ranges: absence, ≤7; mild, 8-16; moderate, 17-27; severe, ≤28
Measure: Assessment of the severity of depression in healthy controls (HC) Time: At disease onset (study baseline)Description: Anxiety is assessed according to Diagnostic and Statistical Manual of Mental Disorders (DSM) -V criteria and with Hamilton Anxiety Rating Scale (HAM-A) using the following ranges: ≤17, easy; 18-24, moderate; over 25, medium-severe
Measure: Assessment of change in the severity of anxiety in atopic dermatitis and psoriasis patients after conventional treatment from study onset (baseline) at week 10 Time: At disease onset (study baseline) and week 10Description: Anxiety is assessed according to Diagnostic and Statistical Manual of Mental Disorders (DSM) -V criteria and with Hamilton Anxiety Rating Scale (HAM-A) using the following ranges: ≤17, easy; 18-24, moderate; over 25, medium-severe
Measure: Assessment of the severity of anxiety in HC Time: At disease onset (study baseline)Description: The total IgE levels are detected using solid-phase, chemiluminescent immunometric assay in an Immulite/Immulite 1000 (Siemens, Germany). Normal ranges are as follow: 0.000-100.0 IU/ml
Measure: Evaluation of changes in serum immunoglobulin E (IgE, IU/ml) levels from study onset (baseline) at week 10 in atopic dermatitis patients Time: At disease onset (study baseline) and week 10Description: The total IgE levels are detected using solid-phase, chemiluminescent immunometric assay in an Immulite/Immulite 1000 (Siemens, Germany). Normal ranges are as follow: 0.000-100.0 IU/ml
Measure: Analysis of serum IgE (IU/ml) levels in HC Time: At disease onset (study baseline)Description: Serum BDNF levels are analyzed using a solid-phase, sandwich, two-site, ELISA (Promega, US; G7610). No measurement scale is used
Measure: Evaluation of changes in serum Brain Derived Neurotrophic Factor (BDNF, ng/ml) levels from study onset (baseline) at week 10 in atopic dermatitis and psoriasis patients Time: At disease onset (study baseline) and week 10Description: Serum BDNF levels are analyzed using a solid-phase, sandwich, two-site, ELISA (Promega, US; G7610). No measurement scale is used
Measure: Analysis of serum BDNF (ng/ml) levels in HC Time: At disease onset (study baseline)Description: The total cortisol levels are detected using solid-phase, chemiluminescent immunometric assay in an Immulite/Immulite 1000 (Siemens, Germany). Normal ranges are as follow: 138-690 nmol/L
Measure: Evaluation of changes in cortisol (nmol/L) levels from study onset (baseline) at week 10 in atopic dermatitis and psoriasis patients Time: At disease onset (study baseline) and week 10Description: The total cortisol levels are detected using solid-phase, chemiluminescent immunometric assay in an Immulite/Immulite 1000 (Siemens, Germany). Normal ranges are as follow: 138-690 nmol/L
Measure: Analysis of serum cortisol (nmol/L) levels in HC Time: At disease onset (study baseline)Description: The total testosterone levels are detected using solid-phase, chemiluminescent immunometric assay in an Immulite/Immulite 1000 (Siemens, Germany). Normal ranges are as follow: men 20-49 years - 72 -853ng/dL; men≥50 years -129-767 ng/dL; women ovulating - 0.010-73.0 ng/dL; women postmenopausal - 0.010-43.0 ng/dL.
Measure: Evaluation of changes in testosterone (ng/dL) levels from study onset (baseline) at week 10 in atopic dermatitis and psoriasis patients Time: At disease onset (study baseline) and week 10Description: The total testosterone levels are detected using solid-phase, chemiluminescent immunometric assay in an Immulite/Immulite 1000 (Siemens, Germany). Normal ranges are as follow: men 20-49 years - 72 -853ng/dL; men≥50 years -129-767 ng/dL; women ovulating - 0.010-73.0 ng/dL; women postmenopausal - 0.010-43.0 ng/dL.
Measure: Analysis of serum testosterone (ng/dL) levels in HC Time: At disease onset (study baseline)Description: DNA extraction and genotyping the BDNF rs6265 (Val66Met) gene polymorphism in AD, PS and HC
Measure: DNA extraction in AD, PS and HC Time: At disease onset (study baseline)Description: EAD and IAD patients will be divided into subgroups in accordance with BDNF gene polymorphism and gender with following assessment of SCORAD scores compared with baseline after conventional treatment at week 10 in each group using unpaired t-test
Measure: Assessment and comparison (Unpaired t-test) of SCORAD scores in extrinsic atopic dermatitis (EAD, IgE level above the normal) and intrinsic atopic dermatitis (IAD, normal IgE level) patients compared with baseline after conventional treatment at week 10 Time: At disease onset (study baseline) and week 10Description: Psoriasis patients will be divided into subgroups in accordance with BDNF gene polymorphism and gender with following assessment of PASI scores compared with baseline after conventional treatment at week 10 in each group.
Measure: Assessment and comparison (Unpaired t-test) of PASI scores in psoriasis patients compared with baseline after conventional treatment at week 10 in accordance with BDNF gene polymorphism (Val/Val; Val/Met;Met/Met) and gender(males, females) Time: At disease onset (study baseline) and week 10Description: Unpaired, two-way ANOVA and Bonferroni means separation tests will be used for multiple comparisons of HAM-D scores in EAD, IAD and PS patients and HC divided into subgroups in accordance with BDNF gene polymorphism and gender at disease onset (baseline) and week 10. Comparisons will include assessment of HAM-D scores in all patients at baseline and week 10 compared with HC, and assessment of data changes at week 10 compared with baseline
Measure: Unpaired, two-way ANOVA and Bonferroni means separation tests for multiple comparisons of HAM-D scores in EAD, IAD, PS and HC Time: At disease onset (study baseline) and week 10Description: Unpaired, two-way ANOVA and Bonferroni means separation tests will be used for multiple comparisons of HAM-A scores in EAD, IAD and PS patients and HC divided into subgroups in accordance with BDNF gene polymorphism and gender at disease onset (baseline) and week 10. Comparisons will include assessment of HAM-A scores in all patients at baseline and week 10 compared with HC, and assessment of data changes at week 10 compared with baseline
Measure: Unpaired, two-way ANOVA and Bonferroni means separation tests for multiple comparisons of HAM-A scores in EAD, IAD,PS and HC Time: At disease onset (study baseline) and week 10Description: Unpaired, two-way ANOVA and Bonferroni means separation tests will be used for multiple comparisons of serum BDNF(ng/ml) levels in EAD, IAD and PS patients and HC divided into subgroups in accordance with BDNF gene polymorphism and gender at disease onset (baseline) and week 10. Comparisons will include assessment of serum BDNF levels in all patients at baseline and week 10 compared with HC, and assessment of data changes at week 10 compared with baseline
Measure: Unpaired, two-way ANOVA and Bonferroni means separation tests for multiple comparisons of serum BDNF (ng/ml) levels in EAD, IAD,PS and HC Time: At disease onset (study baseline) and at week 10Description: Unpaired, two-way ANOVA and Bonferroni means separation tests will be used for comparisons of serum cortisol (nmol/L) levels in EAD, IAD and PS patients and HC divided into subgroups in accordance with BDNF gene polymorphism and gender at disease onset (baseline) and week 10. Comparisons will include assessment of serum cortisol levels in all patients at baseline and week 10 compared with HC, and assessment of data changes at week 10 compared with baseline
Measure: Unpaired, two-way ANOVA and Bonferroni means separation tests for multiple comparisons of serum cortisol (nmol/L) levels in EAD, IAD,PS and HC Time: At disease onset (study baseline) and at week 10Description: Unpaired, two-way ANOVA and Bonferroni means separation tests will be used for multiple comparisons of serum testosterone (ng/dL) levels in EAD, IAD and PS patients and HC divided into subgroups in accordance with BDNF gene polymorphism and gender at disease onset (baseline) and week 10. Comparisons will include assessment of serum testosterone levels in all patients at baseline and week 10 compared with HC, and assessment of data changes at week 10 compared with baseline
Measure: Unpaired, two-way ANOVA and Bonferroni means separation tests for multiple comparisons of serum testosterone (ng/dL) levels in EAD, IAD,PS and HC Time: At disease onset (study baseline) and at week 10Description: Assessment of testosterone/cortisol ratio in EAD, IAD, PS patients and HC divided into BDNF rs6265 gene polymorphism (Val/Val; Val/Met; Met/Met) and gender (males, females) at study baseline and week 10
Measure: Assessment of testosterone/cortisol ratio in EAD, IAD, PS patients and HC in accordance with BDNF rs6265 gene polymorphism and gender Time: At disease onset (study baseline) and at week 10Description: Unpaired, two-way ANOVA and Bonferroni means separation tests will be used for multiple comparisons of testosterone/cortisol ratio in EAD, IAD and PS patients and HC divided into subgroups in accordance with BDNF gene polymorphism and gender at disease onset (baseline) and week 10. Comparisons will include assessment of testosterone/cortisol ratio in all patients at baseline and week 10 compared with HC, and assessment of data changes at week 10 compared with baseline
Measure: Unpaired, two-way ANOVA and Bonferroni means separation tests for multiple comparisons of testosterone/cortisol ratio in EAD, IAD, PS and HC Time: At disease onset (study baseline) and at week 10Description: Correlation analysis of dermatological, psychological and biochemical parameters in EAD, IAD and PS patients, and HC divided into groups in accordance with BDNF rs6265 gene polymorphism (Val/Val; Val/Met; Met/Met) and gender (males, femaes)
Measure: Correlation analysis of studied parameters in dermatological patients and HC Time: At disease onset (study baseline) and week 10The main objective of the study is to analyse the role of a neurotrophic factor (BDNF) as a putative biological marker of the cognitive recovery in schizophrenia following a Cognitive Remediation Therapy (CRT). Additionally, the role as outcome predictors of BDNF serum levels and the Val66met polymorphism and data from functional and structural neuroimaging will be studied.
Additionally, the role as outcome predictors of BDNF serum levels and the Val66met polymorphism and data from functional and structural neuroimaging will be studied. --- Val66met ---
Description: Change Measurements of serum BDNF levels will be carried out by personnel blind to subjects' group assignment. Platelet and serum samples will be diluted with diluent included in the R&D Human BDNF Quantikine Enzym Linked Immunosorbent Assay (ELISA) kit (Yasuhito et al. 1987).
Measure: BDNF (change from baseline serum BDNF levels) Time: Baseline, 1 month and 4 monthsDescription: Change from baseline in Positive and Negative Syndrome Scale (PANSS) scores at time 16 weeks
Measure: Symptoms (Change from baseline in Positive and Negative Syndrome Scale (PANSS) scores) Time: Baseline and 4 monthsThe aim of this study is to assess whether the application of a selective serotonin reuptake inhibitor (SSRI) enhances and prolongs the learning enhancement achieved by anodal transcranial direct current stimulation (atDCS). For this, young and older healthy subjects will be tested with a well established learning paradigm. Results of this study may help to support the application of atDCS also in patients, e.g. with dementia or mild cognitive impairment.
To assess predictors of SSRI-enhanced brain stimulation, genotyping of several learning related polymorphisms will be performed (i.e., APOE, BDNF, Val66Met, COMT, Val158Met, KIBRA, rs17070145, 5-Hydroxytryptamine transporter).. Inclusion Criteria: - right handedness - unobtrusive neuropsychological screening - ability to provide written informed consent - no pathological findings in head MRI - age: 18 to 35 years (young adults) or 50-80 years (older adults) - Highly effective contraception (Pearl Index < 1) or reliable abstinence from any heterosexual relationships in women of childbearing potential Exclusion Criteria: - severe internal or psychiatric disease (especially depression or suicidal thoughts) - epilepsy - cognitive impairment (< SD under age adjusted norm in neuropsychological testing) - concurrent taking of serotonin precursors (tryptophan, 5-HTP) or MAO inhibitors - concurrent taking of tramadol or triptans - concurrent taking of pimozide or linezolid - concurrent taking of other drugs prolonging the QT-interval - long-QT-syndrome - hypokalemia or hypomagnesemia - known intolerance of the study medication - claustrophobia or metallic implants, tattoos (MRI exclusion criteria) - pregnancy or lactation - participation in another drug-interventional clinical trial within the last month or during the entire study - probands that are placed in an institution due to official or judicial order - non-agreement to save and transmit pseudonymised study data within the clinical trial Inclusion Criteria: - right handedness - unobtrusive neuropsychological screening - ability to provide written informed consent - no pathological findings in head MRI - age: 18 to 35 years (young adults) or 50-80 years (older adults) - Highly effective contraception (Pearl Index < 1) or reliable abstinence from any heterosexual relationships in women of childbearing potential Exclusion Criteria: - severe internal or psychiatric disease (especially depression or suicidal thoughts) - epilepsy - cognitive impairment (< SD under age adjusted norm in neuropsychological testing) - concurrent taking of serotonin precursors (tryptophan, 5-HTP) or MAO inhibitors - concurrent taking of tramadol or triptans - concurrent taking of pimozide or linezolid - concurrent taking of other drugs prolonging the QT-interval - long-QT-syndrome - hypokalemia or hypomagnesemia - known intolerance of the study medication - claustrophobia or metallic implants, tattoos (MRI exclusion criteria) - pregnancy or lactation - participation in another drug-interventional clinical trial within the last month or during the entire study - probands that are placed in an institution due to official or judicial order - non-agreement to save and transmit pseudonymised study data within the clinical trial Healthy Young and Older Adults null --- Val66Met ---
Description: Recall score immediately after learning phase (=training of visual-spatial abilities) under tDC stimulation + SSRI application compared to learning under tDC stimulation + placebo.
Measure: Recall score after learning under tDC stimulation + SSRI compared to learning under tDC stimulation + placebo. Time: immediately after end of learning phase (approx. 1 hour)Description: Measurement of recall scores on the evening of the same day after the learning phase (+tDCS + SSRI), the morning of the day after and 1 week later in order to assess the prolongation of atDCS induced learning enhancement by the SSRI.
Measure: prolongation of the atDCS induced learning enhancement by SSRI Time: 1 weekDescription: Measurement of recall scores directly after learning phase after application of atDCS + placebo or sham-tDCS + SSRI vs. sham-tDCS + placebo.
Measure: Increase of learning enhancement by atDCS + placebo or sham-tDCS + SSRI vs. sham-tDCS + placebo Time: immediately after learning phase (approx. 1 hour)Description: Measurement of recall scores on the evening of the same day of learning phase, the morning of the day after and 1 week later under application of atDCS + placebo or sham-tDCS + SSRI vs. sham-tDCS + placebo, in order to assess prolongation of learning enhancement by SSRI.
Measure: prolongation of learning enhancement by atDCS + placebo or sham-tDCS + SSRI vs. sham-tDCS + placebo Time: 1 weekDescription: To assess predictors of SSRI-enhanced brain stimulation, genotyping of several learning related polymorphisms will be performed (i.e., APOE, BDNF, Val66Met, COMT, Val158Met, KIBRA, rs17070145, 5-Hydroxytryptamine transporter).
Measure: genotyping of learning related polymorphisms Time: onceThe Influence of 5-HTTLPR and BDNF Polymorphisms on Anxiety and Mood After Acute Exercise. Introduction: The 5-HTTLPR (SLC6A4) and BDNF (Val66Met) polymorphism presents an action on the modulation of human behavior and has received great attention as a risk factor for several psychiatric disorders. In recent years, a growing number of studies have evaluated the association between these polymorphisms and personality traits related to anxiety and depression. Objectives: To determine the frequencies of 5-HTTLPR and BDNF polymorphisms in a college students population; To determine the influence of 5-HTTLPR and BDNF polymorphisms on mood states and anxiety after acute physical exercise. Material and Methods: Four hundred (400) College students will be assessed. In the first phase of the study, the following procedures will be performed: Screening, Aerobic Fitness Assessment (Step Test), Questionnaires (PAR-Q, Habitual Physical Activity Level, Beck Anxiety and Depression Scale, State-Trait Anxiety, and Perceived Stress Scale), blood sample collection and genotyping. In the second phase of the study, two (2) groups with or without polymorphisms will be selected (for each gene). These groups will be submitted to four conditions (three experimental conditions and one control condition), carried out randomly and separated by an interval of 1 week. In the experimental Conditions the volunteers will perform treadmill exercises sessions (30 minutes) in three different intensities (light, moderate and vigorous) and will respond to the Borg Scale at 10, 20 e 30 minutes. In the control condition the volunteers will be instructed to remain seated (quiet rest), relaxed and silent for 30 minutes. In both conditions, the volunteers will complete the Profile of Mood States (POMS) and State-Anxiety (STAY), 05 (five) minutes before and, 5 (five) and 20 (twenty) minutes following the interventions.
Introduction: The 5-HTTLPR (SLC6A4) and BDNF (Val66Met) polymorphism presents an action on the modulation of human behavior and has received great attention as a risk factor for several psychiatric disorders. --- Val66Met ---
PCR will be performed with the following primers forward (GGCGTTGCCGCTCTGAATGC) and reverse (GAGGGACTGAGCTGGACAACCAC).. Detection of the polymorphism BDNF Val66Met SNP rs6265 genotype (G196A). --- Val66Met ---
The BDNF Val66Met SNP rs6265 genotype (G196A) will be obtained, using a polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method with forward (5'-ACTCTGGAGAGCGTGAAT-3') and reverse (5'-ATACTGTCACAC ACGCTC-3') primers, and further digestion of the PCR product with NlaIII enzyme (Cat. --- Val66Met ---
From the five possible restriction fragments for this Val66Met amplicon, the genotype will be identified by the size and distribution of three bands: 243 bp for the G variant (Val), 168 bp and 75 bp bands for the A variant (Met), and these three bands for GA heterozygotes (Val/Met), on 2.5% (w/v) agarose gel electrophoresis.. Inclusion criteria: - 18-30 years of age; - able to perform physical activities; Non-inclusion criteria: - history of cardiovascular or respiratory diseases; - smoking; - use of psychiatric drugs; - psychotherapy treatment in the last six months. --- Val66Met ---
Description: The POMS questionnaire is an instrument to evaluate mood states. It has 65 items and 6 domains: tension-anxiety, depression, anger-hostility, vigour-activity, fatigue, and confusion- bewilderment. The total mood disturbance score is derived by subtracting the vigour-activity score from the the sum of scores from the other subscales. The iceberg profile is characterized by low raw scores on the tension, depression, anger, fatigue, and confusion scales and above norms (the "water line") on vigor.
Measure: Response of mood states after interventions Time: Change from 5 minutes before the treatments to 5 and 20 minutes after three exercise intensities and quiet restDescription: Anxiety Inventory-STAI trait-state. The scales encompasses 20 items and provides a one-dimensional measurement of anxiety. Range of scores for each subtest is 20-80, the higher score indicating greater anxiety. A cut point of 39-40 has been suggested to detect clinically significant symptoms.
Measure: Response of anxiety after interventions Time: Change from 5 minutes before the treatments to 5 and 20 minutes after three exercise intensities and quiet restDescription: The Physical Activity Readiness Questionnaire (PAR-Q) was originally designed as a screening questionnaire to be self-administered before beginning physical activity. It has been designed to identify the small number of adults for whom physical activity may be inappropriate or those who should have medical advice concerning the type of activity most suitable for them.The people who to answer yes to one or more of seven questions will be advised to consult their doctors before increasing their physical activity. Those who to answer no to all questions will be included in the protocol study.
Measure: Evaluation safety or possible risk of exercising Time: baselineDescription: Habitual Physical Activity Level (BAECKE):The Baecke Questionnaire was developed to measure habitual physical activity. The questionnaire includes items about household activities, sport, and leisure time activities over the past year. The Sport Index is divided into four categories (<1 h; 1-2 hrs; 2-3 hrs; 3-4 hrs and > 4 hrs) and each of these categories has an appropriate coefficient (0.5; 1.5; 2.5; 3.5 and 4.5) Usual daily activity and leisure activity are scored in a range of from 0 to 5. Global PA will be the sum of 3 indexes.
Measure: Habitual Physical Activity Level Time: BaselineDescription: Beck Inventory Anxiety and Depression: The Beck Depression and Anxiety Inventory consists of a self-report questionnaires. These instruments are used to measure the severity of depressive and anxiety episodes.These instruments are widely used by health professionals and researchers in a variety of clinical and research settings. In the Beck Depression Inventory normal score are between 0 and 15; medium depression scores from 15 to 20 (dysphoria), and high depression scores over 20, and in the Beck Anxiety Inventory: 0-9: normal to minimal anxiety;10-18: mild to moderate anxiety;19-29: moderate to severe anxiety and 30-63: severe anxiety.
Measure: Evaluation of depression and anxiety symptoms Time: BaselineDescription: McArdle Step Test was developed to estimate the aerobic capacity of university students. For the test the individual must ascend and descend a step during 3 min with different stepping rates for women and men (22 and 24 steps/min, respective
Measure: Estimation the aerobic capacity Time: BaselineDescription: The detection of the polymorphism in the SLC6A4 gene will be done by the PCR-RFLP method: restriction fragment length polymorphism (RFLP), in which the PCR amplification of the flanking region of the SNP is followed by the digestion reaction with a specific restriction enzyme. The polymorphism of the SLC6A4 gene will be determined by the Polymerase Chain Reaction (PCR) and subsequent gel electrophoresis. PCR will be performed with the following primers forward (GGCGTTGCCGCTCTGAATGC) and reverse (GAGGGACTGAGCTGGACAACCAC).
Measure: Detection of the polymorphism in the SLC6A4 Time: BaselineDescription: The BDNF Val66Met SNP rs6265 genotype (G196A) will be obtained, using a polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method with forward (5'-ACTCTGGAGAGCGTGAAT-3') and reverse (5'-ATACTGTCACAC ACGCTC-3') primers, and further digestion of the PCR product with NlaIII enzyme (Cat. No. R0125S, New England Biolabs). From the five possible restriction fragments for this Val66Met amplicon, the genotype will be identified by the size and distribution of three bands: 243 bp for the G variant (Val), 168 bp and 75 bp bands for the A variant (Met), and these three bands for GA heterozygotes (Val/Met), on 2.5% (w/v) agarose gel electrophoresis.
Measure: Detection of the polymorphism BDNF Val66Met SNP rs6265 genotype (G196A) Time: BaselineThe main purpose of this study is to learn how transcranial magnetic stimulation (TMS) helps improve negative symptoms of schizophrenia. These 'negative symptoms' include anhedonia (the inability to enjoy things), low motivation, and decreased facial expression. TMS is a noninvasive way of stimulating the brain. TMS uses a magnetic field to cause changes in activity in the brain. The magnetic field is produced by a coil that is held next to the scalp. In this study we will be stimulating the brain to learn more about how TMS may improve these symptoms from schizophrenia.
Hypothesis: Brain-derived neurotrophic factor (BDNF) homozygous val-allele carriers of the val66met BDNF gene will show greater response than met-carriers. --- val66met ---
Description: We will evaluate the effect of sham vs active rTMS on negative symptom severity in the group with Cerebellar targeted rTMS and in the group with DLPFC targeted rTMS
Measure: Change in Negative Symptom Severity Time: Before treatment (Baseline) and 1 week post treatmentDescription: We will evaluate the effect of sham vs active rTMS on cerebellar-prefrontal cortex functional connectivity in the group with Cerebellar targeted rTMS and in the group with DLPFC targeted rTMS
Measure: Change in Cerebellar - Prefrontal Functional Connectivity Time: Before treatment (Baseline) and 1 week post treatmentDescription: We will evaluate the effect of sham vs active rTMS on the frequency and severity of auditory hallucinations in the group with Cerebellar targeted rTMS and in the group with DLPFC targeted rTMS
Measure: Change in Auditory Hallucination Severity Time: Before treatment (Baseline) and 1 week post treatmentThis is a pilot study to determine whether a lifestyle medicine intervention following stroke may increase levels of Brain-Derived Neurotrophic Factor (BDNF).
An single nucleotide polymorphism exists on the BDNF gene in 30-50% of the human population that results in an amino acid change from valine (val) to methionine (met) at position 66 (val66met) of the precursor peptide proBDNF. --- val66met ---
Description: Plasma BDNF protein levels, expressed in nanograms per milliliter, measured prior to any exercise upon completion of intervention.
Measure: BDNF level - Final Time: Week 12Description: Plasma BDNF protein levels, expressed in nanograms per milliliter, measured immediately following bout of aerobic exercise.
Measure: BDNF level - Post-exercise Time: Week 6Description: Genotyping of venous blood samples to determine ValVal, MetMet, and ValMet distribution.
Measure: BDNF Genotype Time: BaselineDescription: Measured as VO2 max (ml/kg/min).
Measure: Cardiovascular Fitness - VO2 max Time: Week 12Description: Measured as estimated metabolic equivalents (kcal/kg/hour).
Measure: Cardiovascular Fitness - METs Time: Week 12Description: Total distance walked 6 minutes on a flat surface.
Measure: 6-minute Walk Test Time: Week 12The Investigators have designed this exploratory study in patients suffering from zygapophysial joint mediated pain to investigate if a correlation exists between inter-individual genetic variability (genotype) with treatment response (phenotype). More specifically, the investigators aim to identify any form of correlation between a specific SNP of the BDNF gene (Val66Met) and the effectiveness and/or duration of radiofrequency facet joint neurotomy. The study population is patients suffering from chronic low back pain who have been scheduled for radiofrequency neurotomy following the diagnosis of facet joint mediated pain (using medial branch block test). The investigators will evaluate if a common variant of BDNF gene (Val66Met) can be directly correlated to a significant degree of pain relief following RF treatment, and whether the result of such a procedure can be predicted from a specific genetic profile.
Does the Brain-derived Neurotrophic Factor Val66Met Gene Polymorphism Predict Inter-individual Variation in Responsiveness Following Lumbar Radiofrequency Denervation? --- Val66Met ---
More specifically, the investigators aim to identify any form of correlation between a specific SNP of the BDNF gene (Val66Met) and the effectiveness and/or duration of radiofrequency facet joint neurotomy. --- Val66Met ---
The investigators will evaluate if a common variant of BDNF gene (Val66Met) can be directly correlated to a significant degree of pain relief following RF treatment, and whether the result of such a procedure can be predicted from a specific genetic profile. --- Val66Met ---
Description: Number of patients in each group who report 50% reduction in pain on the visual analogue scale 3 months after radiofrequency denervation for lumbar zygapophysial (facet) joint mediated pain
Measure: Responder Rate Time: 3 monthsDescription: To evaluate whether any specific and/or combination of SNPs observed could be related with the clinical outcomes measured in this study
Measure: Pre-specified Single Nucleotide Polymorphism (SNP) analysis Time: 3 monthsThe aim of this study is to investigate whether a combination of intensive training of visual-spatial abilities (LOCATO task) with anodal transcranial direct current stimulation (tDCS) leads to an improvement of learning and memory in healthy young adults and to examine the underlying neuronal mechanism.
To assess predictors of positive reaction to brain stimulation, genotyping of several learning related polymorphisms will be performed (i.e., APOE, BDNF Val66Met, COMT Val158Met).. Inclusion Criteria: - right handednesss - unobtrusive neuropsychological screening - age: 18-35 years Exclusion Criteria: - severe internal or psychiatric disease - epilepsy - other severe neurological disease, e.g. --- Val66Met ---
Description: Investigation whether the combination of intensive visual-spatial training (LOCATO task) and tDCS leads to improvement of visual-spatial learning and memory measured by the performance in LOCATO task after end of a 3 day period of training compared to sham stimulation.
Measure: performance in LOCATO task (visual-spatial learning and memory) after a combination of intensive visual-spatial training and tDCS Time: immediately after end of a 3 day period of training in tDCS condition vs sham conditionDescription: long term effetcs measured by performance in LOCATO task after end of training and after 1 month compared to control conditions
Measure: long term effects Time: after 1 month vs baselineDescription: Connectivity (measured by resting-state fMRT and correlation analysis) at baseline compared to end of training
Measure: functional changes: Connectivity Time: after end of 3-day cognitive training vs baselineDescription: cortical excitability measured by transcranial magnetic stimulation (TMS)
Measure: cortical excitability Time: at baselineDescription: quality of life as measured by standardized questionaire at baseline compared to quality of life measured 1 month after intervention (training and stimulation vs. training and sham-stimualtion)
Measure: Quality of Life Time: after 1 month vs baselineDescription: memory performance tested at baseline compared to memory performance after the end of a 3-day cognitive training period and after 1 month (posttraining) in training and stimulation vs. training and sham stimulation
Measure: memory Time: immediately after end of 3-day of cognitive training, after 1 month vs. baselineDescription: To assess predictors of positive reaction to brain stimulation, genotyping of several learning related polymorphisms will be performed (i.e., APOE, BDNF Val66Met, COMT Val158Met).
Measure: genotyping of learning related polymorphisms Time: onceThe aim of this study is to investigate whether a combination of intensive training of visual-spatial abilities (LOCATO task) with anodal transcranial direct current stimulation (tDCS) leads to an improvement of learning and memory in healthy older adults and to examine the underlying neuronal mechanism.
To assess predictors of positive reaction to brain stimulation, genotyping of several learning related polymorphisms will be performed (i.e., APOE, BDNF Val66Met, COMT Val158Met).. Inclusion Criteria (old healthy controls): - right handedness - unobtrusive neuropsychological screening - age: 50-90 years Exclusion Criteria: - severe internal or psychiatric disease - epilepsy - other severe neurological diseases, e.g. --- Val66Met ---
Description: Investigation whether the combination of intensive visual-spatial training (LOCATO task) and tDCS leads to an improvement of visual-spatial learning and memory measured by performance in LOCATO task after end of a 3 day training period compared to sham stimulation.
Measure: Performance in LOCATO task (Visual-Spatial learning and memory) after a combination of intensive visual-spatial training and tDCS Time: immediately after the end of a 3 day training period in tDCS condition compared to sham conditionDescription: long term effects measured by performance in LOCATO task after end of training and after 1 month compared to control condition
Measure: long term effects Time: after 1 month vs baselineDescription: Connectivity (measured by resting-state fMRT and correlation analysis) at baseline compared to end of 3 day period of training
Measure: functional changes: Connectivity Time: after end of 3-day period of training vs baselineDescription: measured by transcranial magnetic stimulation (TMS) at baseline
Measure: cortical excitability Time: at baselineDescription: quality of life as measured by standardized questionaire at baseline compared to quality of life measured 1 month after intervention (training and stimulation vs. training and sham-stimualtion)
Measure: Quality of life Time: after 1 month vs baselineDescription: memory performance tested at baseline compared to memory performance after the end of a 3-day cognitive training period and after 1 month (posttraining) in training and stimulation vs. training and sham stimulation
Measure: memory Time: immediately after end of 3-day of cognitive training, after 1 month vs. baselineDescription: affective state measured at baseline compared to affective state measured after the end of a 3-day cognitve training period and after 1 month (posttraining) in training and stimulation vs. training and sham stimulation
Measure: affective state Time: immediately after the end of 3-day cognitive training, after 1 month vs. baselineDescription: To assess predictors of positive reaction to brain stimulation, genotyping of several learning related polymorphisms will be performed (i.e., APOE, BDNF Val66Met, COMT Val158Met).
Measure: genotyping of learning related polymorphisms Time: onceThe aim of this study is to investigate whether a combination of intensive training of visual-spatial abilities (LOCATO task) with anodal transcranial direct current stimulation (tDCS) leads to an improvement in learning and memory in patients with mild cognitive impairment (MCI) and to examine the underlying neuronal mechanism.
To assess predictors of positive reaction to brain stimulation, genotyping of several learning related polymorphisms will be performed (i.e., APOE, BDNF Val66Met, COMT Val158Met).. Inclusion Criteria (MCI patients): - right handedness - amnestic and amnestic plus MCI with: 1. subjective memory impairment; 2. objective memory difficulties, at least 1 SD below gender, age and education adjusted standard values; 3. relatively normal performance in other cognitive domains; 4. no constraints in activities of daily livings 5. age: 50-90 years Exclusion Criteria: - severe internal or psychiatric disease - epilepsy - other severe neurological diseases, e.g. --- Val66Met ---
Description: Investigation whether the combination of intensive visual-spatial training (LOCATO task) and tDCS leads to improvement of visual-spatial learning and memory measured by performance in LOCATO task after end of a 3 day period of training compared to sham stimulation.
Measure: Performance in LOCATO task (Visual-spatial learning and memory) after a combination of intensive visual-spatial training and tDCS Time: immediately after end of a 3-day period of training in tDCS condition vs sham conditionDescription: long term effects measured by performance in LOCATO task in tDCS condition after end of cognitve training and after 1 month compared to control conditions
Measure: long term effects Time: after 1 month vs baselineDescription: Connectivity (measured by resting-state fMRT and correlation analysis) at baseline compared to end of 3 day period of training
Measure: functional changes: Connectivity Time: end of 3-day cognitive training vs baselineDescription: cortical excitability measured by transcranial magnetic stimulation (TMS)
Measure: cortical excitability Time: at baselineDescription: quality of life as measured by standardized questionaire at baseline compared to quality of life measured 1 month after intervention (training and stimulation vs. training and sham-stimualtion)
Measure: Quality of Life Time: after 1 month vs baselineDescription: memory performance tested at baseline compared to memory performance after the end of a 3-day cognitive training period and after 1 month (posttraining) in training and stimulation vs. training and sham stimulation
Measure: memory Time: immediately after end of 3-day of cognitive training, after 1 month vs. baselineDescription: affective state measured at baseline compared to affective state measured after the end of a 3-day cognitve training period and after 1 month (posttraining) in training and stimulation vs. training and sham stimulation
Measure: affective state Time: immediately after the end of 3-day cognitive training, after 1 month vs. baselineDescription: To assess predictors of positive reaction to brain stimulation, genotyping of several learning related polymorphisms will be performed (i.e., APOE, BDNF Val66Met, COMT Val158Met).
Measure: genotyping of learning related polymorphisms Time: oncePrimary Dysmenorrhea (PDM), defined as menstrual pain without discernable organic causes, is inexorably common in adolescent women, about 40-90% of women may suffer from it, and 20% of them can be severe in the context of being refractory to medication, daily function impairment, and having pain of severe degree. Novel therapeutic method is in need for pain alleviation for this particular phenotype. We have previously reported that PDM females may engage motor-cortex based descending pain modulation system in our resting-state functional Magnetic Resonance Imaging (rs-fMRI) and thermal pain-activation fMRI studies. Based on the reported analgesic efficacy of transcranial Direct Current Stimulation (tDCS) on the motor cortex for various experimental painful conditions and clinical pain disorders, we reason that tDCS can be effective for the severe and medication-refractory PDM patients. This study aim to investigate the analgesic efficacy of tDCS in severe PDMs and to elucidate the dynamic brain neuroplasticity in the context of functional connectivity (FC) of pain matrix after tDCS intervention. We will recruit 30 severe PDMs and randomly allocate them to either real or sham group in a triple-blind manner. rs-fMRI for functional connectivity analysis will be performed before and after the tDCS intervention. The imaging data will be correlated with behavioral and psychological measurements. This is the first study in the literature investigating the tDCS efficacy for severe PDM. The result can promise a new possibility for clinical application.
To genotype the single nucleotide polymorphism genotyping (i.e., BDNF Val66Met polymorphism (rs6265), COMT Val158Met polymorphism (rs4680), OPRM1 (rs1799971), 5HTR2A (rs6313), SLC6A4 (rs25531)) from blood specimen. --- Val66Met ---
Description: pain scale; from 0 to 10; score 0: no pain, score 10: unbearable pain
Measure: Visual Analog Scale (VAS) Time: change from baseline (1st menstrual phase, before tDCS) at one month (2nd menstrual phase, with tDCS), change from baseline (1st menstrual phase, before tDCS) at two months (3rd menstrual phase)Description: Resting-state functional magnetic resonance imaging (rs-fMRI) is a well established method of functional magnetic resonance imaging (fMRI) that is used to evaluate regional interactions in the brain that occur in a resting (task-negative) state, when a subject is not performing an explicit task. Functional connectivity is the connectivity between brain regions that share functional properties, it can be defined as the correlation between spatially remote neurophysiological events, expressed as the neural networks of brain.
Measure: Functional connectivity of rs-fMRI Imaging Time: change from baseline (before tDCS, before 2nd menstrual phase) at one week (after tDCS completion), change from baseline (before tDCS, before 2nd menstrual phase) at four weeks (before the 3rd menstrual phase)Description: To assess the threshold of thermal sensation (cold, cold-pain, heat, heat-pain; from 0 to 50 centigrade temperature), according to the established protocol of an ascending limit approach for heat pain and a descending limit approach for cold pain.
Measure: Quantitative sensory testing (QST) Time: change from baseline (before tDCS) at one week (after tDCS completion), change from baseline (before tDCS) at four weeks (before the 3rd menstrual phase), change from baseline (before tDCS) at five weeks (after the 3rd menstrual phase)Description: To assess anxious symptoms; from 20 to 80; score 20: not anxious, score 80: extremely anxious
Measure: Spielberger State-Trait Anxiety Inventory (STAI) Time: change from baseline (before tDCS) at one week (after tDCS completion), change from baseline (before tDCS) at four weeks (before the 3rd menstrual phase), change from baseline (before tDCS) at five weeks (after the 3rd menstrual phase)Description: To assess anxious symptoms; from 0 to 63; score 0: not anxious, score 63: extremely anxious
Measure: Beck Anxiety Inventory (BAI) Time: change from baseline (before tDCS) at one week (after tDCS completion), change from baseline (before tDCS) at four weeks (before the 3rd menstrual phase), change from baseline (before tDCS) at five weeks (after the 3rd menstrual phase)Description: To assess depressive symptoms; from 0 to 63; score 0: not depressed, score 63: extremely depressed
Measure: Beck Depression Inventory (BDI) Time: change from baseline (before tDCS) at one week (after tDCS completion), change from baseline (before tDCS) at four weeks (before the 3rd menstrual phase), change from baseline (before tDCS) at five weeks (after the 3rd menstrual phase)Description: To assess pain-maladaptive psychological status; from 0 to 52; score 0: not pain Catastrophizing , score 52: extremely pain Catastrophizing
Measure: Pain Catastrophizing Scale (PCS) Time: change from baseline (before tDCS) at one week (after tDCS completion), change from baseline (before tDCS) at four weeks (before the 3rd menstrual phase), change from baseline (before tDCS) at five weeks (after the 3rd menstrual phase)Description: To assess pain status; from 0 to 78; score 0: not painful, score 78: extremely painful
Measure: Long-form McGill Pain Questionnaire (MPQ) Time: change from baseline (before tDCS) at one week (after tDCS completion), change from baseline (before tDCS) at four weeks (before the 3rd menstrual phase), change from baseline (before tDCS) at five weeks (after the 3rd menstrual phase)Description: To assess quality of life; he SF-36 consists of eight scaled scores, which are the weighted sums of the questions in their section. Each scale is directly transformed into a 0-100 scale on the assumption that each question carries equal weight. From 0 to 100; score 0: equivalent to maximum disability, score 100: no disability.
Measure: Short-Form Health Survey (SF-36) Time: change from baseline (before tDCS) at one week (after tDCS completion), change from baseline (before tDCS) at five weeks (after the 3rd menstrual phase)Description: To assess testosterone, progesterone, estrogen
Measure: Blood Hormones Measurement Time: change from baseline (before tDCS) at one week (after tDCS completion), change from baseline (before tDCS) at four weeks (before the 3rd menstrual phase)Description: To genotype the single nucleotide polymorphism genotyping (i.e., BDNF Val66Met polymorphism (rs6265), COMT Val158Met polymorphism (rs4680), OPRM1 (rs1799971), 5HTR2A (rs6313), SLC6A4 (rs25531)) from blood specimen
Measure: Genotyping Time: baselineDescription: To assure blinding efficacy; Patients do self-assessment about whether they receive real tDCS or sham tDCS. Assessment questionnaire:1 or 0. 1: real tDCS; 0: sham tDCS.
Measure: Efficacy of tDCS blinding Time: At 1 months after tDCS interventionThis study investigates whether, after six weeks of exercise, a genetic variant (Val66Met) in the gene that makes a molecule (BDNF) important for brain health and function, influences the beneficial effects of a further session of exercise in sedentary, healthy males. The aim of this research is to determine whether not having this genetic variant (Val66Met) provides an advantage for achieving greater exercise-induced benefits. After six consecutive weeks of exercise (high-intensity interval training (HIIT), three times per week), the effects of a further session of exercise on brain activity are studied in healthy, sedentary males with and without the BDNF genetic variant. Further, whether the BDNF genetic variant impacts the effects of six weeks of aerobic exercise on blood BDNF levels, memory and cardiorespiratory fitness is examined. This data will help to understand whether genetic factors moderate the beneficial effects of exercise. Understanding what factors influence the effectiveness of exercise training programs is essential to individualize exercise programs and maximize their positive effects on the brain and during rehabilitation following brain injuries.
Effects of BDNF Val66Met Polymorphism on the Efficacy of Aerobic Exercise in Sedentary, Healthy Males. --- Val66Met ---
Effects of Genetic Variation on the Efficacy of Aerobic Exercise This study investigates whether, after six weeks of exercise, a genetic variant (Val66Met) in the gene that makes a molecule (BDNF) important for brain health and function, influences the beneficial effects of a further session of exercise in sedentary, healthy males. --- Val66Met ---
The aim of this research is to determine whether not having this genetic variant (Val66Met) provides an advantage for achieving greater exercise-induced benefits. --- Val66Met ---
The objective of this research is to determine whether after six consecutive weeks of high-intensity interval training (HIIT), three times per week, BDNF Val66Met polymorphism impacts the effects of a further HIIT session on corticospinal excitability as well as intracortical and spinal circuitry. --- Val66Met ---
Additionally, this study aims to assess whether BDNF Val66Met polymorphism moderates the effects of six consecutive weeks of HIIT on BDNF, working memory and cardiorespiratory fitness levels. --- Val66Met ---
Description: Corticospinal excitability as measured by single-pulse TMS-evoked responses in a hand and forearm muscles.
Measure: Corticospinal excitability Time: 8 weeksDescription: Intracortical circuits as measured by paired-pulse TMS-evoked responses in a hand muscle
Measure: Intracortical circuits Time: 8 weeksDescription: Spinal circuits as measured by spinal Hoffman reflexes from a forearm muscle
Measure: Spinal circuits Time: 8 weeksDescription: Serum levels of BDNF as assessed by ELISA
Measure: Blood BDNF Time: 8 weeksDescription: Serum levels of cathepsin B as assessed by ELISA
Measure: Cathepsin B Time: 8 weeksDescription: Serum levels of IGF-1 as assessed by ELISA
Measure: IGF-1 Time: 8 weeksDescription: Serum levels of VEGF as assessed by ELISA
Measure: VEGF Time: 8 weeksDescription: Serum levels of osteocalcin as assessed by ELISA
Measure: Osteocalcin Time: 8 weeksDescription: Working memory as assessed by the Automated Operation Span (OSPAN) Task
Measure: Working memory Time: 8 weeksDescription: Cardiorespiratory fitness as assessed by VO2 peak test
Measure: Cardiorespiratory fitness Time: 8 weeksHuntington disease (HD, 1.3/10 000) is an autosomal dominant disease due to an abnormal expansion of CAG triplets in HTT gene. Several pathophysiological mechanisms have been evoked, including an alteration of the signaling pathway of the Brain Derived Neurotrophic Factor (BDNF), a neurotrophic factor involved in the survival of neurons (striatal and hippocampal) and synaptic plasticity. BDNF is synthesized at the level of cortical neurons and transported, through the axonal transport in which the Htt is involved, to the nerve endings; it's then secreted in response to excitatory synaptic activity, especially at the level of glutamatergic synapses. Besides, at the postsynaptic level it binds with great specificity to TrkB receptors (tropomyosin-related kinase receptors B) with a neuroprotective effect on dendritic and axonal growth and an increase in synaptic plasticity, especially at the level of the striatum and the hippocampus (Benarroch 2015). BDNF is decreased in the brain of animal models, as well as in patients with HD; the alteration of this pathway would occur in the early stages of the disease (Chiara Zuccato and Cattaneo 2007) (Saudou and Humbert 2016) (Virlogeux et al. 2018). In the context of concomitant multiple treatments, the BNDF pathway may be one of the therapeutic targets of HD. Moreover, in HD it remains essential to detect biological markers representative of the different pathogenic pathways that can be tested in vivo in humans to confirm the hypotheses developed at the level of basic research; these biomarkers could subsequently become biomarkers of disease progression and/or biomarkers of therapeutic efficacy of potential targeted treatments. Therefore, this study aims to characterize potential biomarkers of the BNDF pathway in plasma and CSF in subjects with HD and to confirm the importance of this pathogenic mechanism in vivo in humans.
Patients group: in 90 patients with HD we will perform: a collection of the main anamnestic and clinical data; a blood test for the determination of BDNFpl, Taupl, NFLpl and the genotyping of the Val66Met polymorphism of the BDNF gene; multimodal brain MRI with volumetry, diffusion tensor, functional MRI of rest; a measurement of the UHDRS and TCF scales; neuropsychological tests (SDMT, STROOP test, TMT A and B, digit span). --- Val66Met ---
Description: the BDNF assay will be performed with SIMOA ELISA-type ultrasensitive assay with a QUanterix kit and centralized for the four centers at the Laboratory of Clinical Proteomic Biochemistry, IRMB Montpellier, France.
Measure: BDNF(csf) in HD subjects compared to age-matched control subjects (+/- 5 years) Time: InclusionDescription: Correlation between BDNFlcr / BDNFpl and: disease severity, assessed through the Huntington Disease Rating Scale (UHDRS), the disease burden formula [(n.CAG-35.5) x age], the Total Functional Capacity functional scale (TFC), and cognitive scales (Symbol Digit Modalities Test, STROOP test, Trail Making test A and B, direct and indirect digit span); - MRI brain imaging: cerebral and striatal atrophy by morphological imaging, functional resting state MRI, and anatomical connectivity by diffusion tensor imaging
Measure: Correlation between BDNFlcr / BDNFpl and disease parameters Time: InclusionCognitive impairments have severe impact on functional recovery and quality of life after stroke. Current evidence indicated that combining exercise and cognitive training may provide additional benefits on cognition in stroke. This study aims to investigate the effects and mechanisms of two combined methods of computer-based cognitive training with physical exercise in stroke patients with cognitive impairments.
The Task-based EEG will be collected when participants perform the n-back task before and after the intervention program to examine the effects of training on neural plasticity.. BDNF val66met genotype. --- val66met ---
Saliva samples will be collected at baseline to determine the Brain-Derived Neurotrophic Factor (BDNF) val66met genotype.. Serum BDNF level. --- val66met ---
Description: The Mini-Mental State Exam (MMSE) is used to screen patients for cognitive impairment, track changes in cognitive functioning over time, and often to assess the effects of therapeutic agents on cognitive function. Its range of total score is 0-30 with higher values indicating better cognitive function.
Measure: Change scores of Mini-Mental State Exam (MMSE) Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)Description: The Montreal Cognitive Assessment (MoCA) will be used to assess general cognitive functions. It examines several cognitive domains with a total score of 30 and higher values indicate better cognitive functions. The MoCA has been shown to be a valid and promising tool to evaluate the global cognitive function in patients with stroke. The psychometric properties of MoCA are good to excellent for patients with cerebrovascular diseases.
Measure: Change scores of the Montreal Cognitive Assessment (MoCA). Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)Description: Several subtests of Wechsler Memory Scale - Third Edition (WMS-III) including Faces Recognition (total scale=48), Verbal Paired Associates (total scale = 32), Word Lists (total scale = 48), and Spatial Span (total scale=32) will be used to assess the immediate, delayed, and working memory tests. For each subtest, a higher number indicates better performance in memory function. The raw score of subtests will also be transferred to standardized Z scores and summed to represent an index of general memory function.
Measure: Change scores of Wechsler Memory Scale - Third Edition (WMS-III) Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)Description: The Wechsler Adult Intelligence Scale - Third Edition (WAIS-III) is developed to measure an individual's intelligence level. The Digit Symbol-Coding (score range 0-133) and Matrix Reasoning (range 0-26) subtests will be used.A higher score indicating better performance. The raw score of each subtest will also be transferred to standardized Z scores and summed to represent an index of general cognitive function.
Measure: Change scores of Wechsler Adult Intelligence Scale - Third Edition (WAIS-III) Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)Description: The UFOV is a computer-based visual test containing three subtests: visuomotor processing speed, divided attention, and selective attention (Ball, Edwards, & Ross, 2007). The UFOV has been shown to have good test-retest reliability and validity to assess patients with stroke (George & Crotty, 2010).
Measure: Change scores of Useful Field of View (UFOV) Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)Description: The Stroop Color-Word test assesses the abilities of selective attention, inhibition and executive function. The participants will be tested under congruent and incongruent conditions. In the congruent condition, the participant will name the color ink of a word which is consistent with the written color name; whereas in the incongruent condition the participant will name the color ink differs from the written color name. In both conditions, the number of colors correctly named within 45 seconds will be measured and the performance in the congruent condition will be compared with the incongruent condition (Quaney et al., 2009).
Measure: Change scores of Stroop Color-Word Test Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)Description: The Dual-Task test evaluates the ability of set-shifting. Participants will sit and perform the box and block test (BBT) or walk 10 meters while doing secondary cognitive or motor tasks. Two cognitive secondary tasks will be performed by the participants: (1) arithmetic task: participants will be asked to perform serial subtractions by 7 starting from 100 or random two-digit numbers (e.g., Baetens et al., 2013); (2) tone discrimination task: participants will be presented a number of low and high-pitched tones and they will respond to either the high or low-pitched tones during the trial. Both cognitive task performances will be recorded and the results will be compared to single cognitive task performance. In addition to the cognitive dual-task, participants will perform a motor task (e.g., holding a cup of water) while walking.
Measure: Change scores of Dual-Task test Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)Description: The TUG assesses the dynamic balance ability and mobility. The participants will be required to stand up from a chair, walk 3 meters, turn around, walk back to the chair, and sit down. The test-retest reliability of TUG on individuals with stroke was excellent (Ng & Hui-Chan, 2005).
Measure: Change scores of Timed Up and Go Test (TUG) Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)Description: The 6MWT measures the maximum distance walked over 6 minutes, which assess the endurance and mobility level of the participants. The participants could rest as needed during the course of the test. The test-retest reliability and responsiveness has been established to be high for patients with chronic stroke (Fulk, Echternach, Nof, & O'Sullivan, 2008).
Measure: Change scores of Six-Minute Walk Test (6MWT) Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)Description: Accelerometers will be used to provide an objective measure of the amount of arm movements in real-life situations. The participants will be asked to wear an Actigraphy activity monitor (ActiGraph, Shalimar, FL, USA) on both wrists for 3 consecutive days before and after training to measure the number of moves each minute, and the average counts of move per minute. The participants will be required to wear the device during the day except for doing water-based activities, such as bathing or swimming.The use of actigraphy to measure arm use and physical activity has been established for patients with stroke (Freedson, Melanson, & Sirard, 1998; Maguire et al., 2012).
Measure: Change scores of Mobility Level Time: Baseline, posttest (an expected average of 3 months)Description: The short form version of International Physical Activity Questionnaires (IPAQ) assesses sitting, walking, moderate-intensity activities and vigorous intensity activities. Frequency (measured in days per week) and duration (time per day) are collected separately and transferred to MET-minutes values for each specific type of activity. A combined total physical activity MET-min/week can be computed as the sum of Walking + Moderate + Vigorous MET-min/week scores. Higher total scores indicated more health-related activities.
Measure: Change scores of International Physical Activity Questionnaires (IPAQ) Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)Description: The upper limb subscale of the Fugl-Myer Assessment (FMA-UE) assesses the motor impairments of upper limbs after stroke. The FMA-UE contains 33 movements with a score range from 0 to 66. A higher score indicated better motor recovery in upper limbs.
Measure: Change scores of Fugl-Myer Assessment (FMA) Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)Description: The Rivermead Mobility Index (RMI) evaluates the participant's functional mobility, balance, gait and walking ability. It contains a 15-item scale which includes 14 questions and one direct observation, with a total of score of 15 and higher scores indicating better mobility performance.
Measure: Change scores of Rivermead Mobility Index (RMI) Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)Description: We will evaluate isometric knee flexors and extensors muscle strength using handheld dynamometer. Also, we will use hand dynamometer to measure grip strength of the affected and less affected hand while the participant is seated, with the elbow at 90-degree flexion. We will record the mean value of 3 attempts.
Measure: Change scores of Muscle Strength Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)Description: The FIM assesses the dependence level of individuals with stroke to perform 18 activities (13 motor and five cognitive tasks) in daily living. The score ranges from 18 to 126 and higher scores demonstrate greater independent participation in daily activities (Ottenbacher, Hsu, Granger, & Fiedler, 1996). The FIM has good interrater reliability and validity (Hsueh, Lin, Jeng, & Hsieh, 2002).
Measure: Change scores of Functional Independence Measure (FIM) Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)Description: The Lawton IADL scale evaluates 8 activities with a score range from 0 to 8 (higher indicate better function). The inter-rater reliability and validity of the Lawton IADL have been established to be moderate to high for community-dwelling older adults (Graf, 2008; Lawton & Brody, 1969).
Measure: Change scores of Lawton Instrumental Activities of Daily Living Scale (Lawton IADL) Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)Description: The SIS contains 59 items measuring eight domains, including strength, hand function, ADL/IADL, mobility, communication, emotion, memory/thinking, and participation, with a single item assessing perceived overall recovery from stroke. The total score is the average of the domain scores, and the domain scores are the averages of the item scores (1-5), and higher scores indicate better function or QOL.
Measure: Change scores of Stroke Impact Scale (SIS) Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)Description: The quality of life will be assessed by the EQ-5D questionnaire which comprises the following five dimensions: mobility, self-care, usual activities, pain/discomfort and anxiety/depression. Each dimension has three levels: no problems, some problems, extreme problems. The score has been shown to be reliable and valid (Greiner et al., 2003).
Measure: Change scores of EuroQol-5D Questionnaire (EQ-5D) Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)Description: The social participation level will be assessed with the Community Integration Questionnaire (CIQ).It contains 15 items to evaluate the degree of integration into each of the three area of family, social network, and productive activities. The total scores range from 0 to 29 with larger numbers indicating better integration.
Measure: Change scores of Community Integration Questionnaire (CIQ) Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)Description: The Geriatric Depression Scale (GDS) - 15 items version is a self-administered questionnaire used to evaluate mood and depressive symptoms. The scores range is 0-15 and a score of 5 or greater taken as a possible indicator of depression.
Measure: Change scores of Geriatric Depression Scale (GDS) Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)Description: The Task-based EEG will be collected when participants perform the n-back task before and after the intervention program to examine the effects of training on neural plasticity.
Measure: Task-based Electroencephalogram (EEG) Time: Baseline, posttest (an expected average of 3 months)Description: Saliva samples will be collected at baseline to determine the Brain-Derived Neurotrophic Factor (BDNF) val66met genotype.
Measure: BDNF val66met genotype Time: BaselineDescription: Blood samples will be collected at baseline and after the intervention programs. The blood tests will include serum BDNF level, antioxidative markers, HbA1C level, and Plasma lipid level. Serum BDNF will be quantified using an enzyme-linked immunosorbent assay (Human BDNF Quantitative Immunoassay, DBD00, R&D Systems) according to the manufacturer's instructions. This sandwich ELISA is set in order to measure natural and recombinant human mature BDNF in serum and plasma. All assays will be performed on F-bottom 96-well plates (Nunc, Wiesbaden, Germany).
Measure: Serum BDNF level Time: Baseline, posttest (an expected average of 3 months)Description: Blood samples will be collected at baseline and after the intervention programs. The blood tests will include BDNF level, antioxidative markers, HbA1C level, and Plasma lipid level. Antioxidative markers will be used to reflect the changes on oxidative stress. In particular, we will be analyzing the total antioxidant capacity (TAC).
Measure: Total antioxidant capacity (TAC) Time: Baseline, posttest (an expected average of 3 months)Description: Blood samples will be collected at baseline and after the intervention programs. The blood tests will include BDNF level, antioxidative markers, HbA1C level, and Plasma lipid level. HbA1C level will be tested to investigate the relationships between blood glucose level and aerobic exercise.
Measure: Glucose indicator Time: Baseline, posttest (an expected average of 3 months)Description: Blood samples will be collected at baseline and after the intervention programs. The blood tests will include BDNF level, antioxidative markers, HbA1C level, and Plasma lipid level. The cholesterol ratio (total cholesterol divided by high-density lipid) will be evaluated to reflect the lipid level in the blood.
Measure: Plasma lipid level Time: Baseline, posttest (an expected average of 3 months)Description: The Caregiver Strain Index (CSI) is a tool that can be used to quickly identify families with potential caregiving concerns. It is a 13-question tool that measures strain related to care provision. The reliability and validity has been established (Robinson, 1983).
Measure: Change scores of Caregiver Strain Index (CSI) Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)Description: CBS evaluates the burden of the primary caregiver of the participants, including general strain, isolation, disappointment, emotional involvement, and environment of the caregivers. The CBS for caregivers of stroke patients showed moderate to good test-retest reliability and construct validity (Elmstahl, Malmberg, & Annerstedt, 1996).
Measure: Change scores of Caregiver Burden Scale(CBS) Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)The purpose of the study is to assess the status of brain-derived neurotrophic factor brain (BDNF) and how the brain behaves in response to skill acquisition. Specifically we will investigate the relationship of the status of BDNF with cortical excitability changes and learning that occur during a motor training paradigm. We aim to 1) determine cortical excitability changes by using transcranial magnetic stimulation (TMS) before and after training; 2) to determine finger tracking accuracy before and after training; and 3) determine the presence of BDNF polymorphism in each participant. We are testing healthy adults in this study, and eventually would like to apply to persons who have neurologic disorders such as stroke or dystonia. By applying a magnetic field to the outside of the head, electrical currents are produced within the brain that can stimulate brain tissue. Using TMS, the brain can be studied to gain a greater understanding of the mechanisms associated with cortical excitability in healthy and patient populations. There is limited knowledge of what influence genetic biomarkers such as BDNF have on cortical excitability changes within the cortex following learning. Studies have indicated that people without this certain gene are less likely to show changes in brain excitability during TMS and during motor learning than people with this gene
We will screen for the Val66met polymorphism.. Inclusion Criteria: - 18-45 years - no past history of psychiatric or neurologic disease. --- Val66met ---
Description: A computer quantified tracking performance measure in each test. This is a calculation of accuracy by using the equation: AI = 100(P-E)/P. Where E is the root mean square (r.m.s.) error between the target line and the response line, and P is the size of the individual's target pattern, calculated as the r.m.s. difference between the sine wave and the midline separating the upper and lower phases of the sine wave. The magnitude of P is determined by the scale of the vertical axis, which is the subject's range of finger motion. Therefore, the AI is normalized to each subject's own range of motion and takes into account any differences between subjects in the excursion of the tracking target. The maximum possible score is 100%. Negative scores occur when the response line is so distant from the target that it falls on the opposite side of the midline.
Measure: Accuracy Index Time: Day 1: posttest after trainingDescription: Cortical excitability will be measured with transcranial magnetic stimulation (TMS) single and paired pulse stimulation to measure short-interval intracortical inhibition (SICI), cortical silent period (CSP) and motor evoked potential (MEP) amplitude.
Measure: Cortical Excitability Time: Day 1: baselineDescription: Cortical excitability will be measured with transcranial magnetic stimulation (TMS) single and paired pulse stimulation to measure short-interval intracortical inhibition (SICI), cortical silent period (CSP) and motor evoked potential (MEP) amplitude.
Measure: Cortical Excitability Time: Day 1: posttestDescription: BDNF genetic variant screening will be conducted via saliva sample collected at the end of the session on day 1. We will screen for the Val66met polymorphism.
Measure: BDNF genetic status Time: Day 1Caffeine is a widely used psychostimulant drug and acts as a competitive antagonist at adenosine receptors. Its effect is on neurons and glial cells of all brain areas. Chronic consumption of caffeine leads to tolerance which might be associated with an increased number of binding sites in the brain. In deep brain stimulation (DBS), the production of adenosine following the release of adenosine triphosphate (ATP) explains the reduction of in tremor. Binding of adenosine to adenosine A1 receptor suppresses excitatory transmission in the thalamus and thus reduces both tremor-and DBS-induced side effects. Also, the effect of adenosine was attenuated following the administration of the 8-Cyclopentyl-1,3-dipropylxanthine (DPCPX) adenosine A1 receptor antagonist. Therefore, the presence of a receptor antagonist such as caffeine was suggested to reduce the effectiveness of deep brain stimulation (DBS) in treating tremor and other movement disorders. In light with this finding, we anticipate that the antagonistic effect of caffeine is a culprit to the reduction of effectiveness of any stimulation protocol in non-invasive stimulation (NIBS). In particular the excitatory effects of a NIBS protocol can tentatively be blocked in the presence of caffeine. In this study, the effects of caffeine consumption on cortical excitability at the sensorimotor cortex shall be examined on focal and non-focal plasticity. Focal plasticity will be induced by paired associated stimulation (PAS) and global cortical plasticity from transcranial alternating current (tACS) stimulation. In case of tACS stimulation, 1) an excitatory protocol (tACS, 140 Hz, 1 mA) and 2) an inhibitory protocol (tACS, 140 Hz, 0.4 mA) with the active electrode over M1 and the return electrode over the orbitofrontal cortex will be used. Changes in cortical excitability are assessed using transcranial magnetic stimulation (TMS) recordings. Research goals are to examine the effects of caffeine consumption on sensorimotor cortical excitability and stimulation induced plasticity. In addition, this study explores further factors which usually contribute to variability in cortical excitability studies. The results are expected to give a useful recommendation for researchers to reduce confounding factors and hereby improves repeatability.
Val66Met; Val66Val; Met66Met; Met66Val). --- Val66Met ---
Description: Amplitude of motor evoked potential change (MEP)
Measure: Cortical excitabiliy changes induced by caffeine consumption Time: Baseline (pre-measurement), immediately after intervention, 5 minutes, 10 minutes, 15 minutes, 20 minutes, 25 minutes, 30 minutes, 60 minutesDescription: Valine (Val) and Methionine (Met) alleles (i.e. Val66Met; Val66Val; Met66Met; Met66Val)
Measure: Brain-derived neurotrophic factor (BDNF) gene polymorphisms on cortical plasticity Time: 3-6 monthsCognitive impairment is a core symptom of schizophrenia and is in a large part responsible for the poor psychosocial outcome of the disorder. The use of non-invasive brain stimulation techniques as a therapeutic option is just commencing for neuropsychiatric patients. Concerning healthy subjects the investigators have previously shown that anodal tDCS to the right dorsolateral prefrontal cortex (DLPFC) parallel to working memory training can sustainingly enhance performance in a spatial n-back task. Additionally, first translational experiments regarding the use of anodal tDCS to improve working memory (WM) in patients with schizophrenia rendered promising results. On those grounds, the investigators now test the hypothesis that anodal tDCS to the right DLPFC can augment working memory training in patients with schizophrenia.
Examination of gene polymorphisms (BDNF Val66Met, COMT Val108Met158; CACNA1C) via polymerase chain reaction (PCR).. Influence of age on tDCS effectiveness. --- Val66Met ---
Description: Use of d' and response time as dependent variables. Based on signal detection theory, the discriminability index d' (d-prime) is calculated by using the formula d' = Z(hit rate) − Z(false alarm rate).
Measure: Change (post training - pre training) in working memory task performance (1-,2-,3-back). Time: Pre Training: 3-4 days before training start. Post Training: 3-4 days after completion of working memory training.Description: Trail Making Test (TMT) A and B. Results in seconds will be normalized by age and education adjusted standard values. Slower processing time indicates less cognitive flexibility and processing speed.
Measure: Change (post training - pre training) in cognitive flexibility and processing speed. Time: Pre Training: 3-4 days before training start. Post Training: 3-4 days after completion of training. And changes in follow-up sessions: 4 and 12 weeks after completion of working memory training.Description: Trail Making Test (TMT) A and B. Results in seconds will be normalized by age and education adjusted standard values. Slower processing time indicates less cognitive flexibilty and processing speed.
Measure: Change (follow-up - pre training) in cognitive flexibility and processing speed. Time: Pre Training: 3-4 days before training start. Follow-up sessions: 4 and 12 weeks after completion of working memory training.Description: Measure of different cognitive domains with the Brief Assessment of Cognition in Schizophrenia (BACS). Subscales (Verbal Memory, Working Memory, Motor Function, Verbal Fluency, Speed of Processing, Executive Function) and composite score. Taking age and gender into account, individual test scores are averaged to standardized scores (z-score) . Higher scores indicate better task performance.
Measure: Change (post training - pre training) in cognition. Time: Pre Training: 3-4 days before training start. Post Training: 3-4 days after completion of training. And changes in follow-up sessions: 4 and 12 weeks after completion of working memory training.Description: Measure of different cognitive domains with the Brief Assessment of Cognition in Schizophrenia (BACS). Subscales (Verbal Memory, Working Memory, Motor Function, Verbal Fluency, Speed of Processing, Executive Function) and composite score. Taking age and gender into account, individual test scores are averaged to standardized scores (z-score) . Higher scores indicate better task performance.
Measure: Change (follow-up - pre training) in cognition. Time: Pre Training: 3-4 days before training start. Follow-up sessions: 4 and 12 weeks after completion of working memory training.Description: Use of the d' and response time as dependent variables. Based on signal detection theory, the discriminability index d' (d-prime) is calculated by using the formula d' = Z(hit rate) − Z(false alarm rate).
Measure: Change (follow-up - pre training) in working memory task performance (1-,2-,3-back). Time: Pre Training: 3-4 days before training start. Follow up: 4 and 12 weeks after completion of working memory training.Description: Calgary Depression Scale for Schizophrenia (CDSS). Maximum score is 27. Higher scores indicate a higher level of depression.
Measure: Change (post training - pre training) in depressive symptoms. Time: Pre Training: 3-4 days before training start. Post Training: 3-4 days after completion of training.Description: Calgary Depression Scale for Schizophrenia (CDSS). Maximum score is 27. Higher scores indicate a higher level of depression.
Measure: Change (follow-up - pre training) in depressive symptoms. Time: Pre Training: 3-4 days before training start. Follow-up sessions: 4 and 12 weeks after completion of working memory training.Description: Positive and Negative Syndrome Scale (PANSS). The PANSS measures symptom severity on a positive, a negative and a general psychopathology scale. Higher scores indicate more pronounced symptom severity. The PANSS will be analyzed in subscales and as a summed total score.
Measure: Change (post training - pre training) in psychopathology. Time: Pre Training: 3-4 days before training start. Post Training: 3-4 days after completion of training. And changes in follow-up sessions: 4 and 12 weeks after completion of working memory training.Description: Positive and Negative Syndrome Scale (PANSS). The PANSS measures symptom severity on a positive, a negative and a general psychopathology scale. Higher scores indicate more pronounced symptom severity. The PANSS will be analyzed in subscales and as a summed total score.
Measure: Change (follow-up - pre training) in psychopathology. Time: Pre Training: 3-4 days before training start. Follow-up sessions: 4 and 12 weeks after completion of working memory training.Description: Scale for the Assessment of Negative Symptoms (SANS). The total score is calculated by addition of 5 subscales with a maximum score of 25. A higher score indicates more pronounced negative symptoms.
Measure: Change (post training - pre training) in negative symptoms Time: Pre Training: 3-4 days before training start. Post Training: 3-4 days after completion of training.Description: Scale for the Assessment of Negative Symptoms (SANS). The total score is calculated by addition of 5 subscales with a maximum score of 25. A higher score indicates more pronounced negative symptoms.
Measure: Change (follow-up - pre training) in negative symptoms Time: Pre Training: 3-4 days before training start. And changes in follow-up sessions: 4 and 12 weeks after completion of working memory training.Description: World Health Organization Quality of Life Questionnaire, short version (WHOQOL-BREF). Four major domains are assessed: physical, psychological, social relationships and environment. It consists of 26 items and a maximum score of 130. Higher scores indicate a higher quality of life.
Measure: Change (post training - pre training) in quality of life. Time: Pre Training: 3-4 days before training start. Post Training: 3-4 days after completion of training.Description: World Health Organization Quality of Life Questionnaire, short version (WHOQOL-BREF). Four major domains are assessed: physical, psychological, social relationships and environment. It consists of 26 items and a maximum score of 130. Higher scores indicate a higher quality of life
Measure: Change (follow-up - pre training) in quality of life. Time: Pre Training: 3-4 days before training start. Post Training: 3-4 days after completion of training. And changes in follow-up sessions: 4 and 12 weeks after completion of working memory training.Description: Subjective Scale to Investigate Cognition in Schizophrenia (SSTICS).Scale with 21 items, maximum score of 84, higher scores indicate more subjective cognitive impairment.
Measure: Change (post training - pre training) in subjective cognitive capacity. Time: Pre Training: 3-4 days before training start. Post Training: 3-4 days after completion of training.Description: Subjective Scale to Investigate Cognition in Schizophrenia (SSTICS).Scale with 21 items, maximum score of 84, higher scores indicate more subjective cognitive impairment.
Measure: Change (follow-up - pre training) in subjective cognitive capacity. Time: Pre Training: 3-4 days before training start. Follow-up sessions: 4 and 12 weeks after completion of working memory training.Description: resting state connectivity, event-related potentials (ERP), 32-channel EEG
Measure: Differences in EEG signatures between interventional arms. Time: Pre Training: 3-4 days before training start. Post Training: 3-4 days after completion of trainingDescription: Examination of gene polymorphisms (BDNF Val66Met, COMT Val108Met158; CACNA1C) via polymerase chain reaction (PCR).
Measure: Influence of genetic constitution on tDCS effectiveness Time: Pre Training: 3-4 days before training startDescription: Age in years; demographic questionnaire
Measure: Influence of age on tDCS effectiveness Time: Pre Training: 3-4 days before training startDescription: Sex: male, female, not specified; self report questionnaire
Measure: Influence of sex on tDCS effectiveness Time: Pre Training: 3-4 days before training startBackground: - People with dystonia have serious muscle contractions that cause abnormal movements or postures. This significantly affects their daily lives. The common type is called organic. The other type is psychogenic. People with this type have typical symptoms plus some psychological effects. Researchers will look at how rapid transcranial magnetic stimulation (rTMS) of the brain combined with stimulation of a nerve affects the ability to detect sensations. They will compare the responses of people with different types of dystonia. They will also compare the responses of people with dystonia to responses of people without it. This study may help us learn more about the nature of different types of dystonia. Objectives: - To see whether TMS combined with nerve stimulation affects the brain differently in people with different types of dystonia and those without dystonia. Eligibility: - Individuals at least 18 years old, who are right-handed and have dystonia. - Healthy volunteers at least 18 years old. Design: - Participants will have two clinical visits. Each visit will be a few hours long. They can be done on the same day. - Participants will be screened with a medical history and physical exam. - Participants will take several sensory tests. For these tests, electrodes will be placed on their skin. The participants will feel small electric shocks during some of the tests. - Participants will undergo TMS. For 2 minutes, quick electrical currents will pass through a wire coil placed on their head. As this happens, researchers will ask the participants to move certain muscles.
Outcome Measures Primary outcome variable: Change in MEP amplitudes at T30 from baseline Secondary outcome variables: - Input-output curve parameters (measured at baseline, T0, T30, and T60) - Temporal discrimination threshold (TDT) Exploratory Measures - Short interval intracortical inhibition (SICI), a measure of inhibition in the motor cortex - Influence of Val66Met BDNF polymorphism on the output variables Repeated measures analyses of variance (ANOVA) will be used to investigate the following three factors on the outcome variables: time (four levels: baseline, T0, T30 and T60) and muscle (two levels: APB and FDI) as within-subject factor and group (three levels: organic dystonia, psychogenic dystonia, and healthy controls) as between-subjects factor. --- Val66Met ---
Current medical therapies for depression take weeks to achieve full efficacy, and are ineffective in many patients or cause intolerable side effects, emphasizing the need for a deeper understanding of depression and its treatment. Identifying early brain biomarkers of treatments responses seems necessary to improve antidepressant treatment outcome. In this study we aim to detect early brain responses to a fast acting antidepressant-like treatment administered intravenously during a Real-Time Neurofeedback functional magnetic resonance imaging (MRI) Task to predict antidepressant treatment outcome in depression. At completion of the neuroimaging task, participants will enter a placebo-controlled clinical trial with a selective serotonin reuptake inhibitor (SSRI).
Inferential Reasoning (including cost-benefit analysis): Delayed Discounting of Money Rewards, Iowa Gambling Task, Common Difference effect gambling task and the WCST.. BDNF Val66Met single nucleotide polymorphism(SNP)genotyping. --- Val66Met ---
Description: Affect processing: Emotional Words Task and Facial Emotion Perception test. Attention and Inhibitory Control: Parametric Go/NoGo, Trail Making test and the Stroop Color Word test . Inferential Reasoning (including cost-benefit analysis): Delayed Discounting of Money Rewards, Iowa Gambling Task, Common Difference effect gambling task and the WCST.
Measure: Neuropsychological functioning of patients with depression Time: At baselineDescription: 5ml of blood drawn per participants will be used for genotyping
Measure: BDNF Val66Met single nucleotide polymorphism(SNP)genotyping Time: At baselineThis study is complementary to the main study "Brain Derived Neurotrophic Factor Serum Levels Evolution During the Six Months After Alcohol Withdrawal " NCT01491347. The purpose of this study is to evaluate the Bdnf gene - Val66Met polymorphism in subjects with alcohol dependence according to their alcohol consumption status 6 months after withdrawal (relapse or abstinence), in relation to the presence of psychiatric co-morbidities.
Study of the BDNF- Val66Met Polymorphism in Alcohol-dependent Subjects in Relation to Abstinence After Withdrawal. --- Val66Met ---
Study of the BDNF-Val66Met Polymorphism in Alcohol-dependent Subjects in Relation to Abstinence After Withdrawal This study is complementary to the main study "Brain Derived Neurotrophic Factor Serum Levels Evolution During the Six Months After Alcohol Withdrawal " NCT01491347. --- Val66Met ---
The purpose of this study is to evaluate the Bdnf gene - Val66Met polymorphism in subjects with alcohol dependence according to their alcohol consumption status 6 months after withdrawal (relapse or abstinence), in relation to the presence of psychiatric co-morbidities. --- Val66Met ---
Primary Dysmenorrhea (PDM), defined as menstrual pain without discernable organic causes, is inexorably common in adolescent women, about 40-90% of women may suffer from it, and 20% of them can be severe in the context of being refractory to medication, daily function impairment, and having pain of severe degree. Novel therapeutic method is in need for pain alleviation for this particular phenotype. It has been reported that PDM females may engage motor-cortex based descending pain modulation system in our resting-state functional Magnetic Resonance Imaging (rs-fMRI) and thermal pain-activation fMRI studies. Based on the reported analgesic efficacy of transcranial Direct Current Stimulation (tDCS) on the motor cortex for various experimental painful conditions and clinical pain disorders, it is plausible that tDCS can be effective for the severe and medication-refractory PDM patients. This study aim to investigate the analgesic efficacy of tDCS in severe PDMs and to elucidate the dynamic brain neuroplasticity in the context of experimental pain after tDCS intervention. Thirty severe PDMs will be recruited and randomly allocated to either real or sham group in a triple-blind manner. Experimental pain electrical stimulation will be performed before and after the tDCS intervention. The experimental pain-evoked magnetoencephamographic (MEG) data will be correlated with behavioral and psychological measurements. This is the first study in the literature investigating the tDCS efficacy for acute pain in severe PDM. The result can promise a new possibility for clinical application.
To genotype the single nucleotide polymorphism genotyping (i.e., BDNF Val66Met polymorphism (rs6265), COMT Val158Met polymorphism (rs4680), OPRM1 (rs1799971), 5HTR2A (rs6313), SLC6A4 (rs25531)) from blood specimen. --- Val66Met ---
Description: pain scale; from 0 to 10; score 0: no pain, score 10: unbearable pain
Measure: Visual Analog Scale (VAS) Time: change from baseline (1st menstrual phase, before tDCS) at one month (2nd menstrual phase, with tDCS), change from baseline (1st menstrual phase, before tDCS) at two months (3rd menstrual phase)Description: Somatosensory evoked magnetic fields (SEFs) is a well established magnetoencephalographic (MEG) cortical response evoked by electric stimulation. SEFs to experimental pain stimulation using electrical stimulator applied on the skin over the trajectory of median nerve will be used to evaluate pain-evoked cortical response.
Measure: Somatosensory evoked magnetic fields to experimental pain Time: change from baseline (before tDCS, before 2nd menstrual phase) at one week (after tDCS completion), change from baseline (before tDCS, before 2nd menstrual phase) at four weeks (before the 3rd menstrual phase)Description: To assess the threshold of thermal sensation (cold, cold-pain, heat, heat-pain; from 0 to 50 centigrade temperature), according to the established protocol of an ascending limit approach for heat pain and a descending limit approach for cold pain.
Measure: Quantitative sensory testing (QST) Time: change from baseline (before tDCS) at one week (after tDCS completion), change from baseline (before tDCS) at four weeks (before the 3rd menstrual phase), change from baseline (before tDCS) at five weeks (after the 3rd menstrual phase)Description: To assess anxious symptoms; from 20 to 80; score 20: not anxious, score 80: extremely anxious
Measure: Spielberger State-Trait Anxiety Inventory (STAI) Time: change from baseline (before tDCS) at one week (after tDCS completion), change from baseline (before tDCS) at four weeks (before the 3rd menstrual phase), change from baseline (before tDCS) at five weeks (after the 3rd menstrual phase)Description: To assess anxious symptoms; from 0 to 63; score 0: not anxious, score 63: extremely anxious
Measure: Beck Anxiety Inventory (BAI) Time: change from baseline (before tDCS) at one week (after tDCS completion), change from baseline (before tDCS) at four weeks (before the 3rd menstrual phase), change from baseline (before tDCS) at five weeks (after the 3rd menstrual phase)Description: To assess depressive symptoms; from 0 to 63; score 0: not depressed, score 63: extremely depressed
Measure: Beck Depression Inventory (BDI) Time: change from baseline (before tDCS) at one week (after tDCS completion), change from baseline (before tDCS) at four weeks (before the 3rd menstrual phase), change from baseline (before tDCS) at five weeks (after the 3rd menstrual phase)Description: To assess pain-maladaptive psychological status; from 0 to 52; score 0: not pain Catastrophizing , score 52: extremely pain Catastrophizing
Measure: Pain Catastrophizing Scale (PCS) Time: change from baseline (before tDCS) at one week (after tDCS completion), change from baseline (before tDCS) at four weeks (before the 3rd menstrual phase), change from baseline (before tDCS) at five weeks (after the 3rd menstrual phase)Description: To assess pain status; from 0 to 78; score 0: not painful, score 78: extremely painful
Measure: Long-form McGill Pain Questionnaire (MPQ) Time: change from baseline (before tDCS) at one week (after tDCS completion), change from baseline (before tDCS) at four weeks (before the 3rd menstrual phase), change from baseline (before tDCS) at five weeks (after the 3rd menstrual phase)Description: To assess quality of life; he SF-36 consists of eight scaled scores, which are the weighted sums of the questions in their section. Each scale is directly transformed into a 0-100 scale on the assumption that each question carries equal weight. From 0 to 100; score 0: equivalent to maximum disability, score 100: no disability.
Measure: Short-Form Health Survey (SF-36) Time: change from baseline (before tDCS) at one week (after tDCS completion), change from baseline (before tDCS) at five weeks (after the 3rd menstrual phase)Description: To assess testosterone, progesterone, estrogen
Measure: Blood Hormones Measurement Time: change from baseline (before tDCS) at one week (after tDCS completion), change from baseline (before tDCS) at four weeks (before the 3rd menstrual phase)Description: To genotype the single nucleotide polymorphism genotyping (i.e., BDNF Val66Met polymorphism (rs6265), COMT Val158Met polymorphism (rs4680), OPRM1 (rs1799971), 5HTR2A (rs6313), SLC6A4 (rs25531)) from blood specimen
Measure: Genotyping Time: baselineDescription: To assure blinding efficacy; Patients do self-assessment about whether they receive real tDCS or sham tDCS. Assessment questionnaire:1 or 0. 1: real tDCS; 0: sham tDCS.
Measure: Efficacy of tDCS blinding Time: At 1 months after tDCS interventionThe purpose of this study is to determine the treatment effects of sequential combination of aerobic exercise and cognitive training on cognitive function, physiological markers, daily function, physical function, social participation and quality of life in stroke patients with cognitive decline.
The Chinese version of short form GDS will be used.. Genotyping of the BDNF val66met polymorphism. --- val66met ---
Description: The MoCA will be used to assess general cognitive functions. It examines several cognitive domains with a total score of 30
Measure: Change scores of Montreal Cognitive Assessment (MoCA) Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)Description: The WMS-III is a standardized and reliable neuropsychological examination tool designed to evaluate visuospatial and memory functions
Measure: Change scores of Wechsler Memory Scale - Third Edition (WMS-III) Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)Description: The WAIS-III is developed to measure an individual's intelligence level. It includes tests that evaluate cognitive functions in verbal comprehension, working memory, perceptual organization, and processing speed
Measure: Change scores of Wechsler Adult Intelligence Scale - Third Edition (WAIS-III) Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)Description: The UFOV assessment is a computer-based visual test containing three subtests: visuomotor processing speed, divided attention, and selective attention.
Measure: Change scores of Useful Field of View (UFOV) Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)Description: The Stroop Color-Word assesses the abilities of selective attention, inhibition and executive function. The participants will be tested under congruent and incongruent conditions.
Measure: Change scores of Stroop Color-Word test Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)Description: The dual-task test evaluates the ability to shift attention between one task and another. Participants will perform the box and block test (BBT) while doing secondary cognitive tasks while sitting. Participants will perform BBT by affected and less affected hand.
Measure: Change scores of Dual-task test Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)Description: Up-regulation of neurotrophic and vascular growth factors
Measure: Change scores of serum BDNF level Time: Baseline, posttest (an expected average of 3 months)Description: Antioxidative markers will be used to reflect the changes on oxidative stress. In particular, we will be analyzing the total antioxidant capacity (TAC).
Measure: Change scores of Antioxidative marker Time: Baseline, posttest (an expected average of 3 months)Description: HbA1C level will be tested to investigate the relationships between blood glucose level and aerobic exercise
Measure: Change scores of Glucose indicator Time: Baseline, posttest (an expected average of 3 months)Description: The cholesterol ratio (total cholesterol divided by high-density lipid) will be evaluated to reflect the lipid level in the blood.
Measure: Change scores of Plasma lipid level Time: Baseline, posttest (an expected average of 3 months)Description: The FIM assesses the dependence level of individuals with stroke to perform 18 activities (13 motor and five cognitive tasks) in daily living. The score ranges from 18 to 126 and higher scores demonstrate greater independent participation in daily activities.
Measure: Change scores of Functional Independence Measure (FIM) Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)Description: The Lawton IADL scale assesses independent living skills, such as shopping or managing finances.
Measure: Change scores of Lawton Instrumental Activities of Daily Living Scale (Lawton IADL) Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)Description: The SIS 3.0 will be used to evaluate health-related quality of life for patients with stroke. The SIS assesses eight domains (strength, hand function, ADL/IADL, mobility, communication, emotion, memory and thinking, and participation/role function) with 59 test items.
Measure: Change scores of Stroke Impact Scale (SIS) Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)Description: CB scale evaluates the burden of the primary caregiver of the participants. Lessening the burden of caregivers after the intervention may significantly improve the quality of life for patients with stroke and their family.
Measure: Change scores of Caregiver Burden (CB) scale Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)Description: The quality of life will be assessed by the EQ-5D questionnaire which comprises the following five dimensions: mobility, self-care, usual activities, pain/discomfort and anxiety/depression.
Measure: Change scores of EuroQol (EQ)-5D questionnaire Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)Description: The TUG assesses the dynamic balance ability and mobility. The participants will be required to stand up from a chair, walk 3 meters, turn around, walk back to the chair, and sit down.
Measure: Change scores of Timed up and go test (TUG) Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)Description: The 6MWT measures the maximum distance walked over 6 minutes, which assess the endurance and mobility level of the participants. The participants could rest as needed during the course of the test.
Measure: Change scores of Six-minute walk test (6MWT) Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)Description: Accelerometers will be used to provide an objective measure of the amount of arm movements in real-life situations. The participants will be asked to wear an Actigraphy activity monitor.
Measure: Change scores of Mobility level Time: Baseline, posttest (an expected average of 3 months)Description: The IPAQ is an international measure of health-related physical activity.
Measure: Change scores of International Physical Activity Questionnaires (IPAQ) Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)Description: The UE-FMA subscale will be used to assess the sensorimotor impairment level of UE in patients after stroke. The UE-FMA contains 33 movements with a score range from 0 to 66. A higher UE-FMA score indicates less impairment of the paretic limb. The validity and reliability of FMA is good to excellent.
Measure: Change scores of Fugl-Meyer Assessment (FMA) Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)Description: The RMI evaluates the participant's bed mobility, postural transfers and walking ability. It contains a 15-item scale which includes 14 questions and one direct observation, with a total of score of 15.
Measure: Change scores of Rivermead Mobility Index (RMI) Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)Description: Accelerometers will be used to provide an objective measure of the amount of arm movements in real-life situations. The participants will be asked to wear an Actigraphy activity monitor. We will evaluate isometric knee flexors and extensors muscle strength using handheld dynamometer. Also, we will use hand dynamometer to measure grip strength of the affected and less affected hand while the participant is seated, with the elbow at 90-degree flexion. We will record the mean value of 3 attempts.
Measure: Change scores of muscle strength Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)Description: The CIQ measures items relevant to home integration, social integration, and productive activities.
Measure: Change scores of Community Integration Questionnaire (CIQ) Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)Description: The Chinese version of short form GDS will be used.
Measure: Change scores of Geriatric Depression Scale (GDS) Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)Description: Up-regulation of neurotrophic and vascular growth factors
Measure: Genotyping of the BDNF val66met polymorphism Time: Once during the intervention(an expected average of 3 months)Description: In addition to MAL, the ActiGraph GX3 accelerometers (ActiGraph, Shalimar, FL, USA) will be used to quantitatively assess the amount of arm use in the participants' home settings.The actigraphy will be placed on bilateral wrist for 3 consecutive days before and after the 1-month intervention. The participants will carry the actigraphy all day except for activities that involve water, such as swimming or bathing. Using the actigraphy, investigators will be able to record and calculate the number of hand movements per minute, and the data will be analyzed with the MAHUFFE software (http://www.mrc-epid.cam.ac.uk/). The actigraphy has often been used to evaluate arm use in patients with stroke.
Measure: Change scores of Actigraphy Time: Baseline, posttest (an expected average of 3 months)Description: The Mini-Mental State Examination (MMSE) is the most commonly administered psychometric screening assessment of cognitive functioning. The MMSE is used to screen patients for cognitive impairment, track changes in cognitive functioning over time, and often to assess the effects of therapeutic agents on cognitive function. The total score of MMSE ranged from 0 to 30. Higher values represent a better cognitive functioning.
Measure: Change scores of Mini-Mental State Exam (MMSE) Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)Description: The MRC is an ordinal scale that assesses muscle strength. The scoring for each muscle ranges from 0 to 5, with a higher score indicates stronger muscle. The reliability of MRC for all muscle groups was good to excellent in patients with stroke.
Measure: Change scores of Medical Research Council scale (MRC) Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)Description: The National Institutes of Health Stroke Scale, or NIH Stroke Scale (NIHSS) is a tool used by healthcare providers to objectively quantify the impairment caused by a stroke. The NIHSS is composed of 11 items, each of which scores a specific ability between a 0 and 4. For each item, a score of 0 typically indicates normal function in that specific ability, while a higher score is indicative of some level of impairment. The individual scores from each item are summed in order to calculate a patient's total NIHSS score. The maximum possible score is 42, with the minimum score being a 0.
Measure: Change scores of National Institutes of Health Stroke Scale Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)Depression (Major Depressive Disorder; MDD) has been dubbed "the common cold among the mental illnesses" and it is also a highly recurrent disorder. Secondary prevention has been identified as a key goal in the long-term management of depression. High recurrence rate suggests that there are specific vulnerability factors that increase people's risk for developing repeated episodes of the disorder. Preventive strategies should identify and ameliorate these factors to reduce the individual's risk of subsequent episodes. Biased attention for emotional stimuli is central to the cognitive model where increased sensitivity to negative cues is believed to fuel the negative thoughts and feelings in depression and play a key role in maintaining the illness. Selective biases in attention can be modified by a simple computerized technique; The Attention Bias Modification Task (ABM). This project aims to investigate whether ABM can reduce surrogate and clinical markers of relapse in a large group highly vulnerable to depressive episodes. The effects of ABM, immediately after the two weeks intervention, on three key risk factors for depression will be studied: Residual symptoms, cortisol awakening response and emotion regulation strategies. The participants will be followed up after 1 month, 6 months and 12 months. The hypothesis that ABM will reduce subsequent episodes of low mood over the following 12 months in this group in a manner predicted by early changes in these risk factors will be investigated. It will also be tested if such effects in the lab may be dependent on candidate genes which affect serotonin reuptake and which have been implicated in malleability and emotional learning. Effects on underlying neural correlates of emotion regulation will be studied in an fMRI experiment in a sub-sample and which will also be stratified by serotonin transporter genotype (see also NCT02931487). The predictive value of meta cognitions related to rumination and the possible mediating effects of automatic thoughts and perceived stress will also be investigated in a sub group (see also NCT02648165). The characterization of the cognitive, genetic and neural mechanisms underlying the ABM effect will have key implications for future treatment development and combination with other treatment modalities like pharmacotherapy.
Brain Derived Neurotrophic Factor (BDNF) val66met polymorphic variation linked to Brian Derived Neurotrophic Factor (BDNF) variation will moderate the effect of ABM on residual symptoms compared to neutral ABM placebo condition. --- val66met ---
Description: Beck Depression Inventory
Measure: Change in residual symptoms of depression. Self report. Time: At baseline and immediately after ABM intervention (during first week after ABM).Description: Hamilton Depression Rating Scale
Measure: Change in residual symptoms of depression. Clinician rating Time: At baseline and immediately after ABM intervention (during first week after ABM).Description: Measured by the MINI structured interview
Measure: Recurrence of major depressive episodes Time: Will be measured 12 month after baselineDescription: Emotion Regulation Questionnaire (ERQ).
Measure: Changes in Emotion Regulation Time: At baseline.Description: The Rumination Response Scale
Measure: Changes in Rumination Time: At baseline and 12 months after interventionDescription: Cortisol samples from saliva measured by diural variation (6 samples).
Measure: Changes in cortisol response. Time: At baseline, immediately after ABM intervention and one month after intervention.Description: Beck Anxiety Inventory
Measure: Changes in symptoms of anxiety Time: At baseline, immediately after ABM intervention (during first week after ABM intervention), 1 month after intervention, 6 months after intervention and 12 months after interventionDescription: Automatic Thought Questionnaire (ATQ)
Measure: Automatic thoughts Time: At baseline, immediately after ABM intervention (average one day), 1 month after intervention, 6 months after intervention and 12 months after interventionDescription: Perceived Stress Scale (PSS).
Measure: Changes in perceived stress Time: At baseline, immediately after ABM intervention (average one day), , 1 month after intervention, 6 months after intervention and 12 months after interventionDescription: Positive and Negative Beliefs about Rumination scale (PBRS and NBRS)
Measure: Meta cognitions Time: At baseline and 12 months after interventionDescription: Beck Depression Inventory
Measure: Change in residual symptoms of depression. Self report Time: One month after intervention, 6 months after intervention and 12 months after interventionDescription: Hamilton Depression Rating Scale
Measure: Change in residual symptoms of depression. Clinical rating Time: One month after intervention, 6 month after intervention and 12 month after interventionOur overall objective is to apply Transcranial Magnetic Stimulation (TMS) to develop measures of human synaptic plasticity and of brain excitatory:inhibitory ratio (E:I ratio), which we propose as novel biomarkers and outcome measures that will expedite clinical trials of treatments for Autism Spectrum Disorder (ASD). One potential therapeutic agent, R-baclofen will be investigated under this protocol. TMS is a safe, inexpensive and noninvasive means to focally stimulate the human brain. Presently, TMS is in extensive use as a means to measure regional brain excitability, which is dependent on local synaptic strength. TMS can be used to temporarily alter synaptic strength as well as to acutely measure levels of cortical excitability and short and long interval inhibition. Since altered synaptic plasticity and an imbalanced inhibitory:excitatory ratio are cited as fundamental abnormalities in ASD, we hypothesize that both severity of ASD-related learning deficits and their improvement after therapy will correlate with TMS measures of synaptic plasticity and E:I ratio. We propose to embed TMS measures of synaptic plasticity and E:I ratio in a 'Proof of Principal' trial of R-baclofen and to examine: Aim 1: Whether R-baclofen (a potential therapeutic agent for ASD) predictably alters TMS measures of synaptic plasticity and E:I ratio as a function of plasma concentration in adult volunteers. We will test the following hypotheses: 1. R-baclofen produces a significant change in TMS measures of LTD and E:I ratio; and 2. R-baclofen plasma levels and TMS measures of LTD and E:I ratio show a predictable exposure-response relationship. Exploratory Aim 1: Whether the presence of genetic polymorphisms of the BDNF and GABA-B receptor genes has a moderating effect on TMS measures and on R-baclofen effects. We will test the following hypotheses: 1. Presence of the BDNF val66met allele will be associated with decreased long-term depression (LTD) of cortical excitability 2. Polymorphisms of GABA-B receptor genes will be associated with altered magnitude of response to R-baclofen as measured by TMS
We will test the following hypotheses: 1. Presence of the BDNF val66met allele will be associated with decreased long-term depression (LTD) of cortical excitability 2. Polymorphisms of GABA-B receptor genes will be associated with altered magnitude of response to R-baclofen as measured by TMS percent of baseline TMS-induced measures of (1) human synaptic plasticity (LTD). --- val66met ---
Description: Synaptic plasticity or LTD will be measured using the MEP in response to stimulation set at 80% of the active motor threshold. This MEP will be measured at 90 minutes after study drug dose to establish baseline MEP amplitude then LTD will be induced with the cTBS procedure. The amount of LTD remaining at the different time points, post-cTBS will be quantified by measuring the MEPs and dividing it by the baseline MEP. This will yield a percent of baseline MEP at the various time points.
Measure: percent of baseline TMS-induced measures of (1) human synaptic plasticity (LTD) Time: at 90 minutes after study drug doseThis study proposes to evaluate the effects of D-cycloserine (DCS) combined with Virtual Reality exposure therapy in a sample of patients who developed posttraumatic stress disorder (PTSD) following either the events of September 11, 2001, or military service in the war in Iraq. In addition, this study hopes to determine whether a common human genetic single nucleotide polymorphism (SNP) in a growth factor, brain derived neurotrophic factor, BDNF (Val66Met), predicts treatment response to PTSD. Overall, this study aims 1) to determine if subjects administered DCS show a significantly larger decrease in symptoms of PTSD as compared to those administered a placebo, 2) to determine if subjects administered DCS show a decrease in PTSD symptomatology significantly earlier (as measured by weeks) than those administered a placebo, 3) to determine if differences in symptomatology are evident at a 6-month follow-up and indicate long-term differences between groups, and 4) to determine if the BDNF SNP predicts treatment response.
In addition, this study hopes to determine whether a common human genetic single nucleotide polymorphism (SNP) in a growth factor, brain derived neurotrophic factor, BDNF (Val66Met), predicts treatment response to PTSD. --- Val66Met ---
Description: Total CAPS severity score range is 0-136. Higher values represent a worse outcome (i.e. greater severity of posttraumatic symptoms). CAPS consists of 3 subscales, which are combined to form a total severity score. Subscales: CAPS cluster B (reexperiencing symptoms, range 0-40) CAPS cluster C (avoidance and numbing symptoms, range 0-56) CAPS cluster D (hyperarousal symptoms, range 0-40)
Measure: Clinician Administered PTSD Scale(CAPS) Time: Immediately following treatmentDescription: Total CAPS severity score range is 0-136. Higher values represent a worse outcome (i.e. greater severity of posttraumatic symptoms). CAPS consists of 3 subscales, which are combined to form a total severity score. Subscales: CAPS cluster B (reexperiencing symptoms, range 0-40) CAPS cluster C (avoidance and numbing symptoms, range 0-56) CAPS cluster D (hyperarousal symptoms, range 0-40)
Measure: Clinician Administered PTSD Scale(CAPS) Time: 6-months follow-upDescription: Structured Clinical Interview for DSM-IV - Major Depressive Disorder is a clinical interview to assess presence/absence of Major Depressive Disorder.
Measure: Structured Clinical Interview for DSM-IV - Major Depressive Disorder (SCID-MDD) Time: Immediately following treatmentThis randomized clinical trial studies how well a high-intensity intervention parenting program works in improving learning and school functioning in Latino children with acute leukemia or lymphoblastic lymphoma. A high-intensity intervention program may help doctors to see whether training parents or caregivers in specific parenting skills and "pro-learning" behaviors will result in better learning and school outcomes for Latino children with acute leukemia or lymphoblastic lymphoma. It is not yet known if a high-intensity intervention program is more beneficial than a standard of care lower intensity parenting intervention.
Obtain preliminary data on the relationships between family stress and the Val66Met polymorphism of brain-derived neurotrophic factor (BDNF) with neurocognitive and health-related quality of life (HRQOL) outcomes in Latino children treated with CNS-directed therapies for cancer. --- Val66Met ---
Description: Measured by the parent-reported Pediatric Quality of Life Inventory school domain.
Measure: Change in child's health-related quality of life school functioning Time: Baseline up to 12 monthsDescription: Measured by the Efficacy scale from the Parent Knowledge, Beliefs and Behaviors Questionnaire-3rd Revision (PBQ-R3).
Measure: Change in parental efficacy Time: Baseline up to 12 monthsDescription: Measured by WIAT: reading and math scores and classroom grades from school report cards.
Measure: Objective academic performance (Child) Time: Up to 12 monthsDescription: Measured by the Conners Parent Report Attention subscale.
Measure: Attention performance (Child) Time: Up to 12 monthsDescription: Measured by PBQ-R3 Behaviors Scale.
Measure: Frequency of pro-learning behaviors (Parent) Time: Up to 12 monthsDescription: Measured by the Parents' weekly time spent with child in pro-learning behaviors and activities.
Measure: Frequency of pro-learning behaviors (Parent) Time: Up to 12 monthsDescription: Measured by PBQ-R3 Knowledge scale.
Measure: Knowledge of pro-learning parenting (Parent) Time: Up to 12 months